Originally published as JCO Early Release 10.1200/JCO.2005.02.857 on July 25 2005
Journal of Clinical Oncology, Vol 23, No 25 (September 1), 2005: pp. 5900-5909
© 2005 American Society of Clinical Oncology.
Mutations in the Epidermal Growth Factor Receptor and in KRAS Are Predictive and Prognostic Indicators in Patients With NonSmall-Cell Lung Cancer Treated With Chemotherapy Alone and in Combination With Erlotinib
David A. Eberhard,
Bruce E. Johnson,
Lukas C. Amler,
Audrey D. Goddard,
Sherry L. Heldens,
Roy S. Herbst,
William L. Ince,
Pasi A. Jänne,
Thomas Januario,
David H. Johnson,
Pam Klein,
Vincent A. Miller,
Michael A. Ostland,
David A. Ramies,
Dragan Sebisanovic,
Jeremy A. Stinson,
Yu R. Zhang,
Somasekar Seshagiri,
Kenneth J. Hillan
From the Departments of Pathology, Molecular Diagnostics, Molecular Biology, Biostatistics and BioOncology, Genentech Inc, San Francisco, CA; Department of Medical Oncology, Dana-Farber Cancer Institute, and Departments of Medicine, Brigham and Women's Hospital and Harvard Medical School, Boston, MA; The University of Texas M.D. Anderson Cancer Center, Houston, TX; Vanderbilt Medical Center, Nashville, TN; and Thoracic Oncology Service, Department of Medicine, Memorial Sloan-Kettering Cancer Center, New York, NY
Address reprint requests to Kenneth J. Hillan, MD, Genentech Inc, 1 DNA Way, San Francisco, CA 94080: e-mail: kjh{at}gene.com
 |
ABSTRACT
|
|---|
PURPOSE: Epidermal growth factor receptor (EGFR) mutations have been associated with tumor response to treatment with single-agent EGFR inhibitors in patients with relapsed nonsmall-cell lung cancer (NSCLC). The implications of EGFR mutations in patients treated with EGFR inhibitors plus first-line chemotherapy are unknown. KRAS is frequently activated in NSCLC. The relationship of KRAS mutations to outcome after EGFR inhibitor treatment has not been described.
PATIENTS AND METHODS: Previously untreated patients with advanced NSCLC in the phase III TRIBUTE study who were randomly assigned to carboplatin and paclitaxel with erlotinib or placebo were assessed for survival, response, and time to progression (TTP). EGFR exons 18 through 21 and KRAS exon 2 were sequenced in tumors from 274 patients. Outcomes were correlated with EGFR and KRAS mutations in retrospective subset analyses.
RESULTS: EGFR mutations were detected in 13% of tumors and were associated with longer survival, irrespective of treatment (P < .001). Among erlotinib-treated patients, EGFR mutations were associated with improved response rate (P < .05) and there was a trend toward an erlotinib benefit on TTP (P = .092), but not improved survival (P = .96). KRAS mutations (21% of tumors) were associated with significantly decreased TTP and survival in erlotinib plus chemotherapytreated patients.
CONCLUSION: EGFR mutations may be a positive prognostic factor for survival in advanced NSCLC patients treated with chemotherapy with or without erlotinib, and may predict greater likelihood of response. Patients with KRAS-mutant NSCLC showed poorer clinical outcomes when treated with erlotinib and chemotherapy. Further studies are needed to confirm the findings of this retrospective subset analysis.
 |
INTRODUCTION
|
|---|
Lung cancer is the most common cause of cancer deaths worldwide, and most cases are associated with cigarette smoking.[1] Nonsmall-cell lung cancer (NSCLC) arising in smokers has a different spectrum of molecular abnormalities than those seen in nonsmokers,[2] suggesting differences in molecular etiology, pathogenesis, and possibly prognosis. For example, KRAS mutations occur in 10% to 30% of NSCLC cases, show a strong association with smoking history[3] and have been associated with poor prognosis in several studies.[4-11]
The epidermal growth factor receptor (EGFR) is a receptor tyrosine kinase expressed in the majority of NSCLCs. The efficacy of EGFR inhibitors in preclinical models,[12] together with favorable toxicity profiles, have led to their clinical development for NSCLC and other solid tumors. Erlotinib and gefitinib are small-molecule inhibitors of the EGFR tyrosine kinase, which showed antitumor activity in patients with NSCLC as single agents in phase II trials. A study of erlotinib in 57 patients with relapsed NSCLC demonstrated an objective response rate (ORR) of 12.3%,[13,14] and gefitinib provided an overall response rate of 10.4% in European patients and 27.5% in Japanese patients.[15] Subgroup analyses of 136 NSCLC patients suggest that nonsmokers have a three-fold higher ORR than smokers.[16] In phase III studies of patients with untreated advanced NSCLC, adding gefitinib or erlotinib to chemotherapy did not significantly improve outcome over chemotherapy alone.[17-19] One possible explanation for the failure to observe added benefit in these trials is that patients were not screened and selected for their capability to derive clinical benefit from an EGFR inhibitor, since there is no available test to identify such patients.[20]
Recently, tumor somatic mutations in exons 18 through 21 of the tyrosine kinase domain of EGFR were described in 13 of 14 NSCLC patients who showed objective clinical responses to gefitinib monotherapy, whereas these mutations were not detected in tumors in 11 patients who did not respond.[21,22] The frequency of heterozygous EGFR mutations (amino acid substitutions and in-frame deletions) was 2% to 8% in the United States' population and 26% in Japanese patients. Similarly, mutations were detected in the tumors of 10 of 14 NSCLC patients who responded to erlotinib, and in one of 15 nonresponders.[23,24] The patients with EGFR-mutant tumors had never smoked cigarettes or that they had remote smoking histories.[21] Functional analysis of EGFR mutants in cell lines showed elevated ligand-dependent activation of the receptor, and furthermore revealed that the mutants were inhibited by lower concentrations of gefitinib compared with wild-type EGFR.[21,22] Thus, EGFR mutations may define a subset of tumors that are highly dependent on EGFR signaling and more responsive to EGFR inhibition. It is not yet known whether NSCLC patients with EGFR-mutant tumors experience improved survival with EGFR inhibitor therapy or if there is prognostic significance of the mutations outside the setting of EGFR inhibition.
The RAS/MAPK and PI3K/AKT pathways are major signaling networks linking EGFR activation to cell proliferation and survival.[25] Mutations in these downstream effectors of EGFR signaling could lead to resistance to EGFR inhibitors.[26,27] In NSCLC, the most frequently reported alteration in EGFR signaling pathways is mutation of the KRAS gene.[3-10] Because EGFR and KRAS function sequentially in the MAPK signaling pathway, activating mutations in these two molecules might be functionally redundant and therefore mutually exclusive, where this pathway is dominant for driving tumor growth. A recent study did not find an obvious relationship between KRAS-mutation status and sensitivity to EGFR inhibitors in NSCLC cell lines,[28] but there are no clinical data regarding this relationship in patients.
The present study examined the influence of somatic EGFR and KRAS mutations on the clinical outcome of patients with advanced NSCLC. Tumor DNA was sequenced from a subset of NSCLC patients enrolled on a trial of first-line carboplatin and paclitaxel (CP) with or without erlotinib (TRIBUTE). In contrast to previous studies,[21-24] tumors for sequencing were not preselected based on response or other clinical characteristics. Mutation status was then correlated with clinical data.[19]
 |
PATIENTS AND METHODS
|
|---|
Patient Samples
A phase III randomized trial conducted in the United States, sponsored by Genentech (TRIBUTE), enrolled 1,079 chemotherapy-naïve patients with locally advanced or metastatic (stage IIIB or IV) NSCLC to compare the survival of patients who received erlotinib administered concurrently with a regimen of CP (n = 539) with patients who received CP alone (n = 540). The primary efficacy end point was duration of survival, and the secondary efficacy end points were time to progression (TTP), ORR (defined by RECIST), duration of response, and time to symptomatic progression. The erlotinib-containing arm did not demonstrate any advantage for survival, ORR, TTP, and duration of response over CP alone.[19]
The TRIBUTE clinical protocol was approved by institutional review boards for each participating site and by the US Food and Drug Administration. All patients gave written informed consent for participation in the clinical study. Patients were given the option of providing an additional written informed consent to allow release of their archival tumor samples for research purposes. Seven hundred ten patients provided the second, fully optional, written informed consent for tumor tissue research, and archival pathology specimens were released to Genentech Inc (San Francisco, CA) for 479 of these patients. The specimens from 274 patients contained sufficient quantities of tumor cells to attempt tumor DNA sequencing. The primary pathology reports and histopathologic diagnoses were reviewed by a pathologist (D.A.E. or K.J.H.).
Sequence Analysis
All available tissue samples were evaluated for tumor content and processed for tumor DNA sequencing in blinded fashion, without knowledge of clinical outcome or treatment received.
Formalin-fixed paraffin-embedded tissue sections were stained with hematoxylin and eosin for laser capture microdissection of tumor cells (PixCell II, Arcturus, Mountain View, CA). DNA was extracted from microdissected tissue, and amplifications of exons 18 through 21 of EGFR and exon 2 of KRAS were carried out using nested primers (primer sequences and details of the amplification procedures are provided in Supplemental [Table 1]). Polymerase chain reaction products were sequenced in both sense and antisense directions. EGFR mutations detected in the initial round of sequencing were confirmed by subsequent rounds of independent polymerase chain reaction and sequencing reactions. Only confirmed mutations in both rounds are reported. KRAS mutations identified in the initial sequencing round are reported.
Statistical Analyses
Demographic variables were summarized by mutation status. ORR was summarized by mutation status and treatment received. Formal comparisons across groups were made with Fisher's exact tests (categoric variables) and t tests (continuous variables). Time to event variables (ie, duration of survival and TTP) were summarized by Kaplan-Meier curves. Median time to event was estimated from the Kaplan-Meier curve. Formal comparisons between groups for time-to-event variables were performed via log-rank tests. Hazard ratios were estimated by Cox regression. All hypothesis tests were two-sided. Patients with missing values (including indeterminant tumor mutation status) for a given clinical variable were excluded from any analysis involving that variable.
 |
RESULTS
|
|---|
Baseline demographics of patients with EGFR or KRAS sequence data were analyzed. All examined variables seem balanced between the patients with available tumor DNA sequence and those without (see Supplemental [Table 2] for stage of disease, Eastern Cooperative Oncology Group status, age, smoking, and sex). The outcome variables also seem roughly balanced between the two groups. Median TTP was 4.8 months for patients without sequence versus 5.4 months for patients with sequence (P = .12). Median survival was 10.2 months (without sequence) versus 11.5 months (with sequence; P = .38; Supplemental [Table 2]).
Tumor EGFR mutations were identified in 29 (12.7%) of 228 (95% CI, 8% to 17%) patients ([Tables 1] and [2], and Supplemental [Table 3]). The E746-A750 deletion (15 of 29) and L858R substitution (seven of 29) mutations were the most common, as previously described.[21,22] Five novel mutations (one in exon 18, one in exon 19, and three in exon 20) and three other previously reported mutations were also observed ([Table 2] and Supplemental [Fig 1]). One tumor had mutations in both exons 18 and 20, for a total of 30 mutations. Two of the three mutations observed in exon 20 were insertions, in contrast to the in-frame deletions seen in exon 19; 26 of the 30 mutations were heterozygous.

View larger version (21K):
[in this window]
[in a new window]
|
Fig 1. Kaplan-Meier curves by epidermal growth factor receptor (EGFR) mutation status. One EGFR wild-type patient had a missing value for treatment received and was excluded from [Figures 1C and 1D]. The tick marks indicate patients who were still alive at the time of the analyses or who were censored. All P values refer to log-rank tests. (A) Time to progression, by EGFR mutation status. The P value for patients with EGFR-mutant versus wild-type tumors is < .001. (B) Survival, by EGFR mutation status. The P value for patients with EGFR-mutant versus wild-type tumors is < .001. (C) Time to progression by treatment received and EGFR mutation status: P = .092 for erlotinib plus chemotherapy versus chemotherapy alone among patients with EGFR-mutant tumors (dashed lines) and P = .156 for erlotinib plus chemotherapy versus chemotherapy alone among patients with wild-type tumors (solid lines). (D) Survival by treatment received and EGFR mutation status: P = .958 for erlotinib plus chemotherapy versus chemotherapy alone among patients with EGFR-mutant tumors (dashed lines) and P = .294 for erlotinib plus chemotherapy versus chemotherapy alone among patients with wild-type tumors (solid lines).
|
|
KRAS mutations were detected in DNA from tumors in 55 (21%) of 264 (95% CI, 16% to 26%) patients ([Tables 1] and [2], and Supplemental [Table 3]). KRAS was successfully sequenced more often than EGFR because of the simpler sequencing strategy required. Single amino acid substitutions in codon 12 were most common (51 of 55), whereas codon 13 mutations were found in only four samples ([Table 2] and Supplemental [Fig 1]). Only two patients had tumors carrying both EGFR and KRAS mutations ([Table 1] and Supplemental [Table 3]).
Seventeen percent of patients with EGFR mutations were never smokers, compared with 8% of wild-type patients. Conversely, 17% (33 of 199) of wild-type patients were current smokers, compared with 7% (two of 29) of those with mutations. However, in both EGFR subgroups, three quarters of patients had a previous smoking history, and the overall differences in smoking histories between the subgroups did not reach statistical significance (P = .12; [Table 3]). There is a statistically significant association between EGFR mutations and younger age (median ages were 59 and 64 years for patients with mutant versus wild-type tumors, respectively, P < .01). The presence of KRAS mutations was positively associated with a history of smoking (P < .01); no KRAS mutations were detected in 10 never smokers sequenced. Among patients whose mutation status was determined for both EGFR and KRAS, two patients were mutant for both genes ([Table 1] and Supplemental [Table 3]). If EGFR and KRAS mutations occurred independently, roughly six patients would be expected to have tumors mutant for both genes in this data set. Formal testing of this discrepancy (P = .051) suggests a possible negative association between EGFR and KRAS mutation.
Improved ORR to treatment with erlotinib plus CP was observed among patients with EGFR-mutant tumors (53%) versus patients with wild-type tumors (18%; [Table 4]; P < .01). Among patients with EGFR-mutant tumors, 53% of those treated with erlotinib plus CP achieved response, versus 21% for those treated with CP alone (P = .13). Furthermore, no other pair-wise comparison of ORR was significant (P < .05). Combining treatment arms, an increased percentage of patients with EGFR-mutant tumors (38%) responded to treatment, compared with patients who had wild-type tumors (23%; P = .01).
While tumor response by RECIST may indicate drug activity, for cytostatic agents such as erlotinib, it may be more appropriate to assess clinical benefit by TTP or survival rather than ORR. Both TTP and survival for the patients were affected by EGFR-mutation status. Combining the erlotinib plus CP and CP alone treatment groups, the patients with EGFR-mutant tumors experienced a prolonged median TTP of 8 months, compared with 5 months for those without mutations (P < .001; 95% CI for hazard ratio ]HR[, 0.5 to 0.8; [Fig 1A]). The median survival of patients with wild-type tumors was 10 months (P < .001; 95% CI for HR, 0.1 to 0.5); however, Kaplan-Meier estimates of median survival could not be calculated for the EGFR-mutated subgroup ([Fig 1B]). Comparing treatment arms, there was an increased TTP with erlotinib plus CP treatment (median TTP, 12.5 months) compared with CP alone (median TTP, 6.6 months) in the EGFR-mutated subgroup, but the difference did not reach statistical significance with this number of patients (P = .092; 95% CI for HR, 0.2 to 1.2; [Fig 1C]). There was no discernable difference in the survival curves of EGFR-mutated subgroups between the two treatment arms (P = .96; 95% CI for HR, 0.2 to 3.9; [Fig 1D]). Kaplan-Meier estimates of median survival could not be calculated for the EGFR-mutated subgroups since only four deaths were observed.
The response rate for 209 patients with KRASwild-type tumors was 26%, irrespective of therapy ([Table 4]; 95% CI for difference, 12% to 12%). In patients with KRAS-mutant tumors, ORR was 8% for those receiving erlotinib plus CP, compared with 23% in the subgroup receiving CP alone ([Table 4]; P = .16; 95% CI for difference, 5% to 35%). As seen in [Figure 2], patients with KRAS-mutant tumors who were treated with erlotinib plus CP had shorter median TTP (3.4 months; 95% CI, 1.5 to 6.3 months) and survival (4.4 months; 95% CI, 3.4 to 12.9 months) than the other three patient groups: KRAS mutant and CP alone (TTP: 6 months; 95% CI, 4.9 to 7.1 months; survival: 13.5 months; 95% CI, 11.1 to 15.9 months); KRAS wild-type and CP alone (TTP: 5.4 months; 95% CI, 4.4 to 6.1; survival: 11.3 months; 95% lower confidence limit = 9.1 months), and KRAS wild-type and erlotinib plus CP (TTP: 5.3 months; 95% CI, 4.4 to 6.1 months; survival, 12.1 months; 95% CI, 9.2 to 15.6 months.). Among patients with KRAS-mutant tumors, the HR of erlotinib plus CP versus CP alone was 2.1 (95% CI, 1.1 to 3.8) for survival and 1.9 (95% CI, 1.1 to 3.6) for TTP.

View larger version (12K):
[in this window]
[in a new window]
|
Fig 2. Kaplan-Meier curves by treatment received and KRAS-mutation status. Two KRAS-wild-type patients had missing values for treatment received and were excluded from [Figures 2A and 2B]. The tick marks indicate patients who were still alive at the time of the analyses or who were censored. All P values refer to log-rank tests. (A) Time to progression, by treatment received and KRAS-mutation status: P = .03 for erlotinib plus chemotherapy versus chemotherapy alone among patients with KRAS-mutant tumors (dashed lines) and P = .668 for erlotinib plus chemotherapy versus chemotherapy alone among patients with wild-type tumors (solid lines). (B) Survival, by treatment received and KRAS-mutation status: P = .019 for erlotinib plus chemotherapy versus chemotherapy alone among patients with KRAS-mutant tumors (dashed lines) and P = .792 for erlotinib plus chemotherapy versus chemotherapy alone among patients with wild-type tumors (solid lines).
|
|
 |
DISCUSSION
|
|---|
The phase III TRIBUTE trial did not show improvement in overall clinical benefit for patients with advanced NSCLC when erlotinib was added to first-line combination chemotherapy; however, subgroup analyses have added to our understanding of the potential effects of erlotinib in this setting. Three subgroups of particular interest are nonsmokers, patients with EGFR-mutant tumors, and those with KRAS-mutant tumors. Nonsmokers appear especially responsive to single-agent gefitinib[16] and showed improved survival with erlotinib treatment in TRIBUTE.[19] Lynch et al[21] reported that gefitinib-sensitive patients with EGFR mutations in exons 18 through 21 are likely to have a negative or remote smoking history. In the present study, all available tumors were sequenced from the TRIBUTE trial and showed an overall EGFR mutation frequency of 12.7%. The proportion of patients who were never smokers was higher in the subgroup with EGFR mutations compared with the wild-type subgroup, but the difference in smoking history was not significant overall. Previous observations also associated EGFR mutations with other clinical subsets of NSCLC patients known to be more responsive to gefitinib, including women, patients with a Japanese racial background, and those with adenocarcinoma or bronchioloalveolar tumor subtype.[20,21] There was no significant sex, histologic subtype, or racial difference in EGFR mutation status, though Asian rather than Japanese ethnicity was captured in the clinical database. It is possible that the previously suggested associations between EGFR mutation and various demographic and pathologic parameters seemed stronger because the examined tumors were preselected for response to gefitinib or other clinicopathologic characteristics, whereas no such preselection was performed in the present study.
The majority of the EGFR mutations in this study confirmed those previously reported,[20,21] and five novel mutations were also identified. The majority of the mutations identified were heterozygous, suggesting that they are likely dominant and play a role in tumorigenesis. There was no matched normal tissue available for sequencing, and previous reports indicate that the mutations are likely somatic.[22] As previously noted, the identified mutations cluster around the adenosine triphosphatebinding pocket of the kinase domain and could alter the residues that make contact with adenosine triphosphate or erlotinib, resulting in altered regulation of the kinase.21,22]
Subgroup analysis of TRIBUTE based on tumor EGFR mutation status demonstrated that patients with EGFR mutations showed significantly better clinical outcomes than those with wild-type EGFR in all assessed end points (ORR, TTP, and survival). For this reason, tumor EGFR-mutation status is a favorable prognostic factor. Whether tumor EGFR status is predictive of meaningful clinical benefit specific to erlotinib in combination with chemotherapy is, however, less clear. Patients with EGFR-mutant tumors showed a significantly better ORR than wild-type EGFR when treated with erlotinib plus CP. Among EGFR mutants, ORR was higher in the erlotinib plus CP arm compared with CP alone, but this did not reach statistical significance. These findings are consistent with previous observations[21,22] that suggest EGFR mutations may be associated with greater likelihood of objective response to EGFR inhibitors. There was no observed difference in survival between treatment groups in patients with NSCLC tumors carrying EGFR mutations, though at the time of this analysis, the number of events was too few to allow the determination of median survival in the EGFR-mutated groups. The ability of these data to clearly demonstrate the relationship of EGFR mutation to the clinical effects of erlotinib is confounded by the presence of active chemotherapy and is statistically limited by the relatively small numbers of patients in the subgroups. The statistical limitation is evident in the wide 95% CIs for the HRs between treatment groups among patients with EGFR-mutated tumors: progression-free survival HR, 0.2 to 1.2; survival HR, 0.2 to 3.9. Mutations in codons 12 or 13 account for nearly all KRAS mutations in NSCLC[29] and were detected in 21% of the TRIBUTE tumor samples. In contrast to EGFR mutations, KRAS mutations were not found in never smokers, and there was a tendency for mutations in the two genes to be mutually exclusive of each other. This may indicate a difference in the etiologies of the mutations; for example, smoking-dependent versus -independent. It also could reflect functional redundancy between the two genes so that acquisition of the second mutation confers little additional biologic advantage and does not undergo selection during tumor evolution in tumor cells carrying one mutation.
We hypothesized that activating KRAS mutations might diminish tumor responsiveness to EGFR inhibition since KRAS is downstream of EGFR signaling. The correlation of KRAS status to clinical outcomes showed that patients with KRAS-mutant tumors not only fail to benefit from erlotinib plus CP, but may experience decreased survival and TTP compared with CP alone in the first-line metastatic setting. The observed negative interaction between erlotinib and KRAS mutation is difficult to explain given our present knowledge of the mechanism of erlotinib action and KRAS tumor biology. The clinical data do not support a possible antagonistic interaction between erlotinib and chemotherapy since the response rate in patients with EGFR-mutated tumors was significantly higher in the erlotinib plus CP arm compared with CP alone, and erlotinib treatment resulted in a substantial survival advantage in the prospectively defined subgroup of never smokers in TRIBUTE.[29A] Despite demonstrating statistical significance, the erlotinib-KRAS interaction results must be viewed cautiously, especially since survival results were not overwhelming (P = .019 for survival), and because the study involved multiple subsets and was retrospective. Moreover, the relatively small number of patients with KRAS-mutant tumors increases the likelihood of an imbalance in baseline characteristics that could have been responsible for some or all of the observed difference between treatment groups. Although no such imbalance was found during clinical review and exploratory multivariate modeling efforts (data not shown), this possibility cannot be completely excluded.
While the retrospective analyses of tumor-specific EGFR and KRAS mutations in a subgroup of patients from an overall negative clinical trial has methodological and statistical shortcomings, the findings described generate hypotheses that can be tested prospectively in appropriately designed studies. The present findings suggest that testing for EGFR mutations could be of prognostic importance for patients with NSCLC, but the relevance of such testing in selecting NSCLC patients for erlotinib therapy remains unclear. The implications of these observations are particularly intriguing when considered in context of recent results from BR.21, a randomized phase III trial of single-agent erlotinib in unselected second- and third-line NSCLC patients. The trial demonstrated a 42.5% improvement in median survival (4.7 v 6.7 months) and a 41% relative improvement in 1-year survival rates (21% v 32%) compared with placebo,[30] so it is possible that retrospective analyses of tumor samples from patients in the BR.21 trial might provide a stronger indication of whether or not EGFR mutations are associated with the survival benefit of erlotinib. Definitive answers will require larger prospective trials with mandatory tissue testing, sufficiently powered to demonstrate erlotinib treatment effect in subgroups identified by EGFR status.
 |
Editors Note
|
|---|
A related article on this subject will be published in the November 1, 2005, issue titled Epidermal Growth Factor Receptor Mutations and Gene Amplification in NonSmall-Cell Lung Cancer: Molecular Analysis of the IDEAL/INTACT Gefitinib Trials; by Daphne W. Bell, Thomas J. Lynch, Sara M. Haserlat, Patricia L. Harris, Ross A. Okimoto, Brian W. Brannigan, Dennis C. Sgroi, Beth Muir, Markus J. Riemenschneider, Renee Bailey Iacona, Annetta D. Krebs, David H. Johnson, Giuseppe S. Giaccone, Roy S. Herbst, Christian Manegold, Masahiro Fukuoka, Mark G. Kris, Jose Baselga, Judith S. Ochs, and Daniel A. Haber.
 |
Appendix
|
|---|
The following investigators provided tissue blocks and/or unstained sections from one or more of their patients enrolled on the TRIBUTE clinical trial; without their enthusiasm and hard work this study would not have been possible: Abramson N, Jacksonville, FL; Abubakr Y, Jacksonville, FL; Anderson T, Bedford, TX; Anthony S, Spokane, WA; Arseneau J, Amsterdam, NY; Beck T, Boise, ID; Belt R, Westwood, MT; Berry W, Cary, NC; Bhaskar B, Orange, CA; Breyer W, Provo, UT; Bushunow P, Rochester, NY; Butler R, Charlotte, NC; Canfield V, Norman, OK; Chittoor S, Mesquite, TX; Chu L, Sarasota, FL; Cobb P, Billings, MT; Cohn A, Denver, CO; Del Prete S, Stamford, CT; Deutsch M, Raleigh, NC; DiBella N, Aurora, CO; Dowlati A, Cleveland, OH; Dreisbach P, Rancho Mirage, CA; Entmacher M, Mt Holly, NJ; Fanucchi M, Atlanta, GA; Fehrenbacher L, Vallejo, CA; Figueroa J, Lubbock, TX; Fitzgibbons J, Eugene, OR; Fleagle J, Boulder, CO; Flynn P, St Louis Park, MN; Fox S, Paoli, PA; Frank R, Norwalk, CT; Gabrail N, Canton, OH; Geils G, Charleston, SC; Gill A, Aiken, SC; Greco F, Nashville, TN; Grunberg S, Burlington, VT; Gucalp R, Bronx, NY; Guerra M, Miami, FL; Gupta V, St Joseph, MO; Gutierrez M, Fort Lauderdale, FL; Hajdenberg J, Atlanta, GA; Hamm J, Louisville, KY; Harker G, Salt Lake City, UT; Harper H, Hackensack, NJ; Harrer G, Great Falls, MT; Hart L, Fort Myers, FL; Herbst R, Houston, TX; Hermann R, Marietta, GA; Hoffman P, Chicago, IL; Hoffman S, Altoona, PA; Iannotti N, Port St Lucie, FL; Jahan T, San Francisco, CA; Johnson B, Boston, MA; Kaywin P, Miami, FL; Khandelwal P, Odessa, TX; Kramer A, San Francisco, CA; Langer C, Philadelphia, PA; Lawrence D, Boston, MA; Lindquist D, Sedona, AZ; Link D, Littleton, CO; Lipton A, Hershey, PA; Loesch D, Greenfield, IN; Marsland T, Orange Park, FL; McCann J, Springfield, MA; McCroskey R, Puyallup, WA; McIntyre K, Dallas, TX; McMahon R, Englewood, CO; Mintzer D, Philadephia, PA; Myo T, Baltimore, MD; Oliff I, Skokie, IL; Olivares J, Garland, TX; Olsen M, Tulsa, OK; Orlowski R, Hickory, NC; O'Rourke M, Greenville, SC; Osborn D, Olympia, WA; Otero H, Seattle, WA; Otsuka A, Lakewood, CO; Papish S, Morristown, NJ; Patel T, Columbus, OH; Paulson R, Dallas, TX; Pluard T, St Charles, MO; Polikoff J, San Diego, CA; Rearden T, St Louis, MO; Ribeiro M, Decatur, GA; Richards D, Tyler, TX; Rivkin S, Seattle, WA; Robbins G, Hudson, FL; Robert N, Annandale, VA; Ross H, Portland, OR; Saidman B, Kingston, PA; Sandler A, Nashville, TN; Savin M, Dallas, TX; Schwartzberg L, Memphis, TN; Smith D, Oregon City, OR; Stone J, Jacksonville, FL; Strickland D, Memphis TN; Tai M, Albany, NY; Tezcan H, Coeur d'Alene, ID; Thachil J, Wichita Falls, TX; Townley P, Omaha, NE; Vivacqua R, Upland, PA; Wax M, Summit, NJ; Weisberg T, Scarborough, ME; Westberg M, Des Moines, IA; Wierman A, Las Vegas, NV; Wiesenfeld M, Cedar Rapids, IA; Wiznitzer I, Boca Raton, FL; Yates S, Gastonia, NC; Zielinski R, Williamsville, NY.
Supplemental Table 1. Oligonucleotides and Protocols for PCR and Sequencing EGFR oligonucleotides for PCR <5pEGFR.ex18.out> CAAATGAGCTGGCAAGTGCCGTGTC <3pEGFR.ex18.out> GAGTTTCCCAAACACTCAGTGAAAC <5pEGFR.ex19.out> GCAATATCAGCCTTAGGTGCGGCTC <3pEGFR.ex19.out> CATAGAAAGTGAACATTTAGGATGTG <5pEGFR.ex20.out> CCATGAGTACGTATTTTGAAACTC <3pEGFR.ex20.out> CATATCCCCATGGCAAACTCTTGC <5pEGFR.ex21.out> CTAACGTTCGCCAGCCATAAGTCC <3pEGFR.ex21.out> GCTGCGAGCTCACCCAGAATGTCTGG <5pEGFR.ex18.in.m13f> TGTAAAACGACGGCCAGTCAAGTGCCGTGTCCTGGCACCCAAGC <3pEGFR.ex18.in.m13r> CAGGAAACAGCTATGACCCCAAACACTCAGTGAAACAAAGAG <5pEGFR.ex19.in.m13f> TGTAAAACGACGGCCAGTCCTTAGGTGCGGCTCCACAGC <3pEGFR.ex19.in.m13r> CAGGAAACAGCTATGACCCATTTAGGATGTGGAGATGAGC <5pEGFR.ex20.in.m13f> TGTAAAACGACGGCCAGTGAAACTCAAGATCGCATTCATGC <3pEGFR.ex20.in.m13r> CAGGAAACAGCTATGACCGCAAACTCTTGCTATCCCAGGAG <5pEGFR.ex21.in.m13f> TGTAAAACGACGGCCAGTCAGCCATAAGTCCTCGACGTGG <3pEGFR.ex21.in.m13r> CAGGAAACAGCTATGACCCATCCTCCCCTGCATGTGTTAAAC KRAS oligonucleotides for PCR <5pKRAS-out> TACTGGTGGAGTATTTGATAGTG <3pKRAS-out> CTGTATCAAAGAATGGTCCTG <5pKRAS-in.m13f> TGTAAAACGACGGCCAGTTAGTGTATTAACCTTATGTG <3pKRAS-in.m13r> CAGGAAACAGCTATGACCACCTCTATTGTTGGATCATATTCG(continued on following page)Supplemental Table 1. Oligonucleotides and protocols for PCR and sequencing (continued) Sequencing Primers: <m13f> TGTAAAACGACGGCCAGT <m13r> CAGGAAACAGCTATGACC PCR and sequencing methods Formalin-fixed paraffin embedded tissue sections were deparaffinized and stained with H&E in preparation for laser capture microdissection of tumor cells (PixCell II, Arcturus). Tumor was collected from multiple sections in cases where there were fewer than 500 tumor cells per section. DNA was extracted by incubating dissected tissue in 40 ml PicoPure Proteinase K extraction buffer (Arcturus, Mountainview, CA) for 48 hours at 65°C. The digest was heat inactivated at 95°C for 10 minutes and added directly to PCR reactions. Amplification of exons 18-21 of EGFR and exon 2 of KRAS was carried out using nested primers (primers are listed in Supplemental Table 1). One µl of digested DNA was added to a 50 µl reaction containing 0.5 µM of each primer, 0.2 µM of each dNTP, 1.5 mM MgCl2 and 1.5 U of a taq/pwo blend (Expand High Fidelity PCR system, Roche Molecular Biochemicals, Indianapolis, IN). PCR reactions were run in a PT200 MJ Thermocycler (MJ Research, Inc. Waltham, MA) using the following cycling conditions: an initial incubation at 94°C for 3 minutes, 35 cycles of 94°C for 30 seconds, 58°C for 30 seconds and 72°C for 1 minute, followed by a final extension at 72°C for 8 minutes. Second-step reactions with nested primers were cycled 30 times, otherwise using the same conditions. The presence of an appropriate PCR product was confirmed by resolving the PCR products on a 2% agarose gel. PCR products were purified using the QIAquick PCR Purification Kit (Qiagen, Valencia, CA) and sequenced using fluorescent dye-terminator chemistry (Applied Biosystems, Foster City CA). Sequencing reaction products were resolved using a 3700 sequencing instrument (Applied Biosystems, Foster City, CA). Mutations were identified by visual analysis of the sequence chromatograms using Sequencher (GeneCodes, MI).
Supplemental Table 2. Demographics of Patients With Tumors Sequenced Versus Patients With Tumors Not Sequenced Disease stage (IIIB or IV)20311.548920 Sequenced (n = 274)Unsequenced (n = 793) No.%No.% Gender Male1615948962 Age, years Median6463 Range24 to 8226 to 84 Smoking history Never2599011 Previous2037454569 Current461715820 Disease stage (IIIB or IV) IV2358665683 ECOG status (0 or 1) 11816651164 Median TTP, months5.44.8 Median survival, months11.510.2
NOTE: P values are shown only when P < .05. Abbreviations: ECOG, Eastern Cooperative Oncology Group; TTP, time to progression. Patients with missing values for a given clinical variable were excluded from any analysis involving that variable.
 |
Authors' Disclosures of Potential Conflicts of Interest
|
|---|
Although all authors have completed the disclosure declaration, the followig authors or their immediate family members have indicated a financial interest. No conflict exists for drugs or devices used in a study if they are not being evaluated as part of the investigation. For a detailed description of the disclosure categories, or for more information about ASCOs conflict of interest policy, please refer to the Author Disclosure Declaration and the Disclosures of Potential Conflicts of Interest section in Information for Contributors.
| Authors |
Employment |
Leadership |
Consultant |
Stock |
Honoraria |
Research Funds |
Testimony |
Other |
|
| David A. Eberhard |
Genentech Inc |
|
|
Genentech Inc (B) |
|
|
|
|
| Lukas C. Amler |
Genentech Inc |
|
|
Genentech Inc (B) |
|
|
|
|
| Audrey D. Goddard |
Genentech Inc |
|
|
Genentech Inc (B) |
|
|
|
|
| Sherry L. Heldens |
Genentech Inc |
|
|
Genentech Inc (B) |
|
|
|
|
| Roy S. Herbst |
|
|
Genentech Inc (A) |
|
|
Genentech Inc (C) |
|
|
| William L. Ince |
|
|
|
Genentech Inc (A) |
|
|
|
|
| Thomas Januario |
Genentech Inc |
|
|
Genentech Inc (A) |
|
|
|
|
| David H. Johnson |
|
|
Genentech Inc (A) |
|
|
Genentech Inc (A) |
|
|
| Pam Klein |
Genentech Inc |
|
|
|
|
|
|
|
| Vincent A. Miller |
|
|
AstraZeneca (A) |
|
AstraZeneca (A);Genentech Inc (A) |
|
|
|
| Michael A. Ostland |
Genentech Inc |
|
|
Genentech Inc (C) |
|
|
|
|
| David A. Ramies |
Genentech Inc |
|
|
|
|
|
|
|
| Dragan Sebisanovic |
Genentech Inc |
|
|
|
|
|
|
|
| Jeremy A. Stinson |
Genentech Inc |
|
|
Genentech Inc (B) |
|
|
|
|
| Yu R. Zhang |
Genentech Inc |
|
|
Genentech Inc (A) |
|
|
|
|
| Somasekar Seshagiri |
Genentech Inc |
|
|
Genentech Inc (B) |
|
|
|
|
| Kenneth J. Hillan |
Genentech Inc |
Genentech Inc (C) |
|
Genentech Inc (C) |
|
|
|
|
|
Dollar Amount Codes (A) < $10,000 (B) $10,000-99,999 (C) $100,000 (N/R) Not Required

View larger version (32K):
[in this window]
[in a new window]
|
Supplemental Fig 1. Mutations in epidermal growth factor receptor (EGFR) and KRAS in patient samples. (A-D). Multiple sequence alignments for each EGFR exon where mutations were observed are shown. The amino acids corresponding to the wild-type sequence are shown on top, in the reference wild-type sequence. Point mutations are shown in red and in-frame deletions are shown as gaps in the alignment. (E) Multiple sequence alignments of mutations identified in KRAS. The wild-type protein sequence is shown on top of the alignment. Point mutations are shown in red below the wild-type sequence. (F) Schematic representations of the EGFR mutations in the EGFR kinase domain. The ligand binding, transmembrane (T), and tyrosine kinase domains are shown on the full-length receptor. An expanded view of the tyrosine kinase domain with the positions and identities of the mutations is presented.
|
|
 |
Acknowledgment
|
|---|
We thank the patients who participated in the TRIBUTE clinical trial, and their families, particularly those who consented to the use of their archival tumor material for research; Genentech's Oligonucleotide synthesis and DNA Sequencing groups; and Patti Tobin and Michelle Gossage for technical assistance.
 |
NOTES
|
|---|
This work was supported by Genentech Inc.
Presented in an oral presentation by P. Jänne at the 40th Annual Meeting of the American Society of Clinical Oncology, New Orleans, LA, June 7, 2004; and in a poster presentation at European Organization for Research and Treatment of Cancer National Cancer InstituteAmerican Association for Cancer Research Conference on "Molecular Targets and Cancer Therapeutics," Geneva, Switzerland, September 30, 2004.
Drs Eberhard and Johnson contributed equally to the article.
Authors' disclosures of potential conflicts of interest are found at the end of this article.
 |
REFERENCES
|
|---|
1. Parkin DM, Bray FI, Devasa SS: Cancer burden in the year 2000: The global picture. Eur J Cancer 37:S4-S66, 2001
2. Sanchez-Cespedes M, Ahrendt SA, Piantadosi S, et al: Chromosomal alterations in lung adenocarcinoma from smokers and nonsmokers. Cancer Res 61:1309-1313, 2001[Abstract/Free Full Text]
3. Ahrendt SA, Decker PA, Alawi EA, et al: Cigarette smoking is strongly associated with mutation of the K-ras gene in patients with primary adenocarcinoma of the lung. Cancer 92:1525-1530, 2001[CrossRef][Medline]
4. Grossi F, Loprevite M, Chiaramondia M, et al: Prognostic significance of K-ras, p53, bcl-2, PCNA, CD34 in radically resected non-small cell lung cancers. Eur J Cancer 39:1242-1250, 2003
5. Broermann P, Junker K, Brandt BH, et al: Trimodality treatment in stage III non small cell lung carcinoma: Prognostic impact of K-ras mutations after neoadjuvant therapy. Cancer 94:2055-2062, 2002[CrossRef][Medline]
6. Huncharek M, Muscat J, Geschwind JF: K-ras oncogene mutation as a prognostic marker in non-small cell lung cancer: A combined analysis of 881 cases. Carcinogen 20:1507-1510, 1999[Abstract/Free Full Text]
7. Nelson HH, Christiani DC, Mark EJ, et al: Implications and prognostic value of K-ras mutation for early-stage lung cancer in women. J Nat Can Inst 91:2032-2038, 1999
8. Rajagopalan H, Bardelli A, Lengauer C, et al: Tumorigenesis: RAF/RAS oncogenes and mismatch-repair status. Nature 418:934, 2002[CrossRef][Medline]
9. Keller SM, Vangel MG, Adak S, et al: The influence of gender on survival and tumor recurrence following adjuvant therapy of completely resected stages II and IIIa non-small cell lung cancer. Lung Cancer 37:303-309, 2002[CrossRef][Medline]
10. Schiller JH, Adak S, Feins RH, et al: Lack of prognostic significance of p53 and K-ras mutations in primary resected non-small-cell lung cancer on E4592: A laboratory ancillary study on an Eastern Cooperative Oncology Group prospective randomized trial of postoperative adjuvant therapy. J Clin Oncol 19:448-457, 2001[Abstract/Free Full Text]
11. Graziano SL, Gamble GP, Newman NB, et al: Prognostic significance of K-ras codon 12 mutations in patients with resected stage I and II non-small-cell lung cancer. J Clin Oncol 17:668-675, 1999[Abstract/Free Full Text]
12. Akita RW, Sliwkowski MX: Preclinical studies with erlotinib (Tarceva). Semin Oncol 30:15-24, 2003
13. Perez-Soler R, Chachoua A, Hammond LA, et al: Determinants of tumor response and survival with erlotinib in patients with non-small-cell lung cancer. J Clin Oncol 22:3238-3247, 2004[Abstract/Free Full Text]
14. Sandler A: Clinical experience with the HER1/EGFR tyrosine kinase inhibitor erlotinib. Oncology (Huntington) 17:17-22, 2003
15. Fukuoka M, Yano S, Giaccone G, et al: Multi-institutional randomized phase II trial of gefitinib for previously treated patients with advanced non-small-cell lung cancer. J Clin Oncol 21:2237-2246, 2003[Abstract/Free Full Text]
16. Miller VA, Kris MG, Shah N, et al: Bronchioloalveolar pathologic subtype and smoking history predict sensitivity to gefitinib in advanced non-small-cell lung cancer. J Clin Oncol 22, 2004
17. Giaccone G, Herbst RS, Manegold C, et al: Gefitinib in combination with gemcitabine and cisplatin in advanced non-small-cell lung cancer: A phase III trial - INTACT 1. J Clin Oncol 22:777-784, 2004[Abstract/Free Full Text]
18. Herbst RS, Giaccone G, Schiller JH, et al: Gefitinib in combination with paclitaxel and carboplatin in advanced non-small-cell lung cancer: A phase III trial-INTACT 2. J Clin Oncol 22:785-794, 2004[Abstract/Free Full Text]
19. Herbst RS, Prager D, Hermann R, et al: TRIBUTE: A phase III trial of erlotinib HCI (OSI-774) combined with carboplatin and paclitaxel (CP) chemotherapy in advanced non-small cell lung cancer (NSCLC). J Clin Oncol 22:617, 2004 (abstr 7011)
20. Baselga J: Combining the anti-EGFR agent gefitinib with chemotherapy in non-small-cell lung cancer: How do we go from INTACT to impact? J Clin Oncol 22:759-761, 2004[Free Full Text]
21. Lynch TJ, Bell DW, Sordella R, et al: Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small-cell lung cancer to gefitinib. N Engl J Med 350:2129-2139, 2004[Abstract/Free Full Text]
22. Paez JG, Jänne PA, Lee JC, et al: EGFR mutations in lung cancer: Correlation with clinical response to gefitinib therapy. Science 304:1497-1500, 2004[Abstract/Free Full Text]
23. Pao W, Miller V, Zakowski M, et al: EGF receptor gene mutations are common in lung cancers from "never smokers" and are associated with sensitivity of tumors to gefitinib and erlotinib. Proc Natl Acad Sci U S A 101:13306-13311, 2004[Abstract/Free Full Text]
24. Johnson BE, Lucca J, Rabin MS, et al: Preliminary results from a phase II study of the epidermal growth factor receptor tyrosine kinase inhibitor erlotinib in patients >70 years of age with previously untreated advanced non-small cell lung carcinoma. J Clin Oncol 22:633, 2004 (abstr 7080)
25. Yarden Y, Sliwkowski MX: Untangling the ErbB signalling network. Nat Rev Mol Cell Biol 2:127-137, 2001[CrossRef][Medline]
26. Bianco R, Shin I, Ritter CA, et al: Loss of PTEN/MMAC1/TEP in EGF receptor-expressing tumor cells counteracts the antitumor action of EGFR tyrosine kinase inhibitors. Oncogene 22:2812-2822, 2003[CrossRef][Medline]
27. She Q-B, Solit Basso A, et al: Resistance to gefitinib in PTEN-null HER-overexpressing tumor cells can be overcome through restoration of PTEN function or pharmacologic modulation of constitutive phosphatidylinositol 3'-kinase/Akt pathway signaling. Clin Cancer Res 9:4340-4346, 2003[Abstract/Free Full Text]
28. Suzuki T, Nakagawa T, Endo H, et al: The sensitivity of lung cancer cell lines to the EGFR-selective tyrosine kinase inhibitor ZD1839 ('Iressa') is not related to the expression of EGFR or HER-2 or to K-ras gene status. Lung Cancer 42:35-41, 2003[CrossRef][Medline]
29. Sugio K, Ishida T, Yokoyama H, et al: Ras gene mutations as a prognostic marker in adenocarcinoma of the human lung without lymph node metastasis. Cancer Res 52:2903-2906, 1992[Abstract/Free Full Text]
29. Herbst RS, Prager D, Hermann R, et al: TRIBUTE: A phase III trial of erlotinib HCl (OSI-774) combined with carboplatin and paclitaxel chemotherapy in advanced nonsmall-cell lung cancer. J Clin Oncol 23: 10.1200/JCO.2005.02.840
30. Shepherd FA, Pereira J, Ciuleanu TE, et al: A randomized placebo-controlled trial of erlotinib in patients with advanced non-small cell lung cancer (NSCLC) following failure of 1st line or 2nd line chemotherapy. J Clin Oncol 22:18, 2004 (abstr 7022)
Submitted March 16, 2005;
accepted March 23, 2005.

CiteULike Complore Connotea Del.icio.us Digg Facebook Reddit Technorati Twitter What's this?
Related Editorial
- Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors Plus Chemotherapy: Case Closed or Is the Jury Still Out?
David R. Gandara and Paul H. Gumerlock
JCO 2005 23: 5856-5858
[Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
R. Luthra and Z. Zuo
COLD-PCR Finds Hot Application in Mutation Analysis
Clin. Chem.,
December 1, 2009;
55(12):
2077 - 2078.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A Fassina, A Gazziero, D Zardo, M Corradin, E Aldighieri, and G P Rossi
Detection of EGFR and KRAS mutations on trans-thoracic needle aspiration of lung nodules by high resolution melting analysis
J. Clin. Pathol.,
December 1, 2009;
62(12):
1096 - 1102.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. S. Leidner, P. Fu, B. Clifford, A. Hamdan, C. Jin, R. Eisenberg, T. J. Boggon, M. Skokan, W. A. Franklin, F. Cappuzzo, et al.
Genetic Abnormalities of the EGFR Pathway in African American Patients With Non-Small-Cell Lung Cancer
J. Clin. Oncol.,
November 20, 2009;
27(33):
5620 - 5626.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Siena, A. Sartore-Bianchi, F. Di Nicolantonio, J. Balfour, and A. Bardelli
Biomarkers Predicting Clinical Outcome of Epidermal Growth Factor Receptor-Targeted Therapy in Metastatic Colorectal Cancer
J Natl Cancer Inst,
October 7, 2009;
101(19):
1308 - 1324.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. R. Blumenschein Jr, U. Gatzemeier, F. Fossella, D. J. Stewart, L. Cupit, F. Cihon, J. O'Leary, and M. Reck
Phase II, Multicenter, Uncontrolled Trial of Single-Agent Sorafenib in Patients With Relapsed or Refractory, Advanced Non-Small-Cell Lung Cancer
J. Clin. Oncol.,
September 10, 2009;
27(26):
4274 - 4280.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. T. Shaw, B. Y. Yeap, M. Mino-Kenudson, S. R. Digumarthy, D. B. Costa, R. S. Heist, B. Solomon, H. Stubbs, S. Admane, U. McDermott, et al.
Clinical Features and Outcome of Patients With Non-Small-Cell Lung Cancer Who Harbor EML4-ALK
J. Clin. Oncol.,
September 10, 2009;
27(26):
4247 - 4253.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Horn and W. Pao
EML4-ALK: Honing In on a New Target in Non-Small-Cell Lung Cancer
J. Clin. Oncol.,
September 10, 2009;
27(26):
4232 - 4235.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. L.H. Snozek, D. J. O'Kane, and A. Algeciras-Schimnich
Pharmacogenetics of Solid Tumors: Directed Therapy in Breast, Lung, and Colorectal Cancer: A Paper from the 2008 William Beaumont Hospital Symposium on Molecular Pathology
J. Mol. Diagn.,
September 1, 2009;
11(5):
381 - 389.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. J. Mandrekar and D. J. Sargent
Clinical Trial Designs for Predictive Biomarker Validation: Theoretical Considerations and Practical Challenges
J. Clin. Oncol.,
August 20, 2009;
27(24):
4027 - 4034.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Ocak, M. L. Sos, R. K. Thomas, and P. P. Massion
High-throughput molecular analysis in lung cancer: insights into biology and potential clinical applications
Eur. Respir. J.,
August 1, 2009;
34(2):
489 - 506.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Schmid, N. Oehl, F. Wrba, R. Pirker, C. Pirker, and M. Filipits
EGFR/KRAS/BRAF Mutations in Primary Lung Adenocarcinomas and Corresponding Locoregional Lymph Node Metastases
Clin. Cancer Res.,
July 15, 2009;
15(14):
4554 - 4560.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. C. GARASSINO, K. BORGONOVO, A. ROSSI, A. MANCUSO, O. MARTELLI, A. TINAZZI, S. DI COSIMO, N. LA VERDE, P. SBURLATI, C. BIANCHI, et al.
Biological and Clinical Features in Predicting Efficacy of Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors: A Systematic Review and Meta-analysis
Anticancer Res,
July 1, 2009;
29(7):
2691 - 2701.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Brambilla and A. Gazdar
Pathogenesis of lung cancer signalling pathways: roadmap for therapies
Eur. Respir. J.,
June 1, 2009;
33(6):
1485 - 1497.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. D. RICE, J. E. BUSH, and S. L. BROWER
Assessment of Erlotinib in Chemoresponse Assay
Anticancer Res,
June 1, 2009;
29(6):
1993 - 1997.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. J. Freeman, T. Bush, S. Ogbagabriel, B. Belmontes, T. Juan, C. Plewa, G. Van, C. Johnson, and R. Radinsky
Activity of panitumumab alone or with chemotherapy in non-small cell lung carcinoma cell lines expressing mutant epidermal growth factor receptor
Mol. Cancer Ther.,
June 1, 2009;
8(6):
1536 - 1546.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. W. Tyner, M. W. Deininger, M. M. Loriaux, B. H. Chang, J. R. Gotlib, S. G. Willis, H. Erickson, T. Kovacsovics, T. O'Hare, M. C. Heinrich, et al.
RNAi screen for rapid therapeutic target identification in leukemia patients
PNAS,
May 26, 2009;
106(21):
8695 - 8700.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Dubey and C. A. Powell
Update in Lung Cancer 2008
Am. J. Respir. Crit. Care Med.,
May 15, 2009;
179(10):
860 - 868.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. De Oliveira Duarte Achcar, M. N. Nikiforova, and S. A. Yousem
Micropapillary Lung Adenocarcinoma: EGFR, K-ras, and BRAF Mutational Profile
Am J Clin Pathol,
May 1, 2009;
131(5):
694 - 700.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. J. Riely, J. Marks, and W. Pao
KRAS Mutations in Non-Small Cell Lung Cancer
Proceedings of the ATS,
April 15, 2009;
6(2):
201 - 205.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. K. Dy and A. A. Adjei
Emerging Therapeutic Targets in Non-Small Cell Lung Cancer
Proceedings of the ATS,
April 15, 2009;
6(2):
218 - 223.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. E. Stinchcombe and M. A. Socinski
Current Treatments for Advanced Stage Non-Small Cell Lung Cancer
Proceedings of the ATS,
April 15, 2009;
6(2):
233 - 241.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Sartori, A. Cavazza, A. Sgambato, A. Marchioni, F. Barbieri, L. Longo, M. Bavieri, B. Murer, E. Meschiari, S. Tamberi, et al.
EGFR and K-ras Mutations Along the Spectrum of Pulmonary Epithelial Tumors of the Lung and Elaboration of a Combined Clinicopathologic and Molecular Scoring System to Predict Clinical Responsiveness to EGFR Inhibitors
Am J Clin Pathol,
April 1, 2009;
131(4):
478 - 489.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Staal, M. J. O'Connell, and C. J. Allegra
The Marriage of Growth Factor Inhibitors and Chemotherapy: Bliss or Bust?
J. Clin. Oncol.,
April 1, 2009;
27(10):
1545 - 1548.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Gandhi, K. L. McNamara, D. Li, C. L. Borgman, U. McDermott, K. A. Brandstetter, R. F. Padera, L. R. Chirieac, J. E. Settleman, and K.-K. Wong
Sunitinib Prolongs Survival in Genetically Engineered Mouse Models of Multistep Lung Carcinogenesis
Cancer Prevention Research,
April 1, 2009;
2(4):
330 - 337.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. R. Grandis and A. Argiris
Targeting Angiogenesis from Premalignancy to Metastases
Cancer Prevention Research,
April 1, 2009;
2(4):
291 - 294.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Jimeno, W. A. Messersmith, F. R. Hirsch, W. A. Franklin, and S. G. Eckhardt
KRAS Mutations and Sensitivity to Epidermal Growth Factor Receptor Inhibitors in Colorectal Cancer: Practical Application of Patient Selection
J. Clin. Oncol.,
March 1, 2009;
27(7):
1130 - 1136.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Nakanishi, S. Matsumoto, R. Iwakawa, T. Kohno, K. Suzuki, K. Tsuta, Y. Matsuno, M. Noguchi, E. Shimizu, and J. Yokota
Whole Genome Comparison of Allelic Imbalance between Noninvasive and Invasive Small-Sized Lung Adenocarcinomas
Cancer Res.,
February 15, 2009;
69(4):
1615 - 1623.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Laurent-Puig, A. Lievre, and H. Blons
Mutations and Response to Epidermal Growth Factor Receptor Inhibitors
Clin. Cancer Res.,
February 15, 2009;
15(4):
1133 - 1139.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Pantaleo, M. Nannini, A. Maleddu, S. Fanti, C. Nanni, S. Boschi, F. Lodi, G. Nicoletti, L. Landuzzi, P. L. Lollini, et al.
Experimental results and related clinical implications of PET detection of epidermal growth factor receptor (EGFr) in cancer
Ann. Onc.,
February 1, 2009;
20(2):
213 - 226.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Socinski
What Guides Decisions about the Use of Epidermal Growth Factor Receptor Antibody or Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors in Advanced Non-small Cell Lung Cancer?
ASCO Educational Book,
January 1, 2009;
2009(1):
436 - 443.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. L. Evans
Novel, Targeted Agents with Thoracic Radiation in the Treatment of Locally Advanced Non-small Cell Lung Cancer
ASCO Educational Book,
January 1, 2009;
2009(1):
445 - 449.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Takano, T. Fukui, Y. Ohe, K. Tsuta, S. Yamamoto, H. Nokihara, N. Yamamoto, I. Sekine, H. Kunitoh, K. Furuta, et al.
EGFR Mutations Predict Survival Benefit From Gefitinib in Patients With Advanced Lung Adenocarcinoma: A Historical Comparison of Patients Treated Before and After Gefitinib Approval in Japan
J. Clin. Oncol.,
December 1, 2008;
26(34):
5589 - 5595.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Morgan, L. A. Parsels, J. Maybaum, and T. S. Lawrence
Improving Gemcitabine-Mediated Radiosensitization Using Molecularly Targeted Therapy: A Review
Clin. Cancer Res.,
November 1, 2008;
14(21):
6744 - 6750.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. S. Herbst and A. Sandler
Bevacizumab and Erlotinib: A Promising New Approach to the Treatment of Advanced NSCLC
Oncologist,
November 1, 2008;
13(11):
1166 - 1176.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Dennis
Abstract PL01-04: The role of regulatory T cells in K-Ras driven lung cancer
Cancer Prevention Research,
November 1, 2008;
1(7_MeetingAbstracts):
PL01-04 - PL01-04.
|
 |
|

|
 |

|
 |
 
I. Fichtner, J. Rolff, R. Soong, J. Hoffmann, S. Hammer, A. Sommer, M. Becker, and J. Merk
Establishment of Patient-Derived Non-Small Cell Lung Cancer Xenografts as Models for the Identification of Predictive Biomarkers
Clin. Cancer Res.,
October 15, 2008;
14(20):
6456 - 6468.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. D. Girnun, L. Chen, J. Silvaggi, R. Drapkin, L. R. Chirieac, R. F. Padera, R. Upadhyay, S. B. Vafai, R. Weissleder, U. Mahmood, et al.
Regression of Drug-Resistant Lung Cancer by the Combination of Rosiglitazone and Carboplatin
Clin. Cancer Res.,
October 15, 2008;
14(20):
6478 - 6486.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. R. Hirsch, M. Varella-Garcia, R. Dziadziuszko, Y. Xiao, S. Gajapathy, M. Skokan, M. Lin, V. O'Neill, and P. A. Bunn Jr.
Fluorescence In situ Hybridization Subgroup Analysis of TRIBUTE, a Phase III Trial of Erlotinib Plus Carboplatin and Paclitaxel in Non-Small Cell Lung Cancer
Clin. Cancer Res.,
October 1, 2008;
14(19):
6317 - 6323.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. S. Herbst, J. V. Heymach, and S. M. Lippman
Lung Cancer
N. Engl. J. Med.,
September 25, 2008;
359(13):
1367 - 1380.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Personeni, S. Fieuws, H. Piessevaux, G. De Hertogh, J. De Schutter, B. Biesmans, W. De Roock, A. Capoen, M. Debiec-Rychter, J.-L. Van Laethem, et al.
Clinical Usefulness of EGFR Gene Copy Number as a Predictive Marker in Colorectal Cancer Patients Treated with Cetuximab: A Fluorescent In situ Hybridization Study
Clin. Cancer Res.,
September 15, 2008;
14(18):
5869 - 5876.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C.-Q. Zhu, G. da Cunha Santos, K. Ding, A. Sakurada, J.-C. Cutz, N. Liu, T. Zhang, P. Marrano, M. Whitehead, J. A. Squire, et al.
Role of KRAS and EGFR As Biomarkers of Response to Erlotinib in National Cancer Institute of Canada Clinical Trials Group Study BR.21
J. Clin. Oncol.,
September 10, 2008;
26(26):
4268 - 4275.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. E. Stinchcombe and M. A. Socinski
Gefitinib in Advanced Non-Small Cell Lung Cancer: Does It Deserve a Second Chance?
Oncologist,
September 1, 2008;
13(9):
933 - 944.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Zannetti, F. Iommelli, R. Fonti, A. Papaccioli, J. Sommella, A. Lettieri, G. Pirozzi, R. Bianco, G. Tortora, M. Salvatore, et al.
Gefitinib Induction of In vivo Detectable Signals by Bcl-2/Bcl-xL Modulation of Inositol Trisphosphate Receptor Type 3
Clin. Cancer Res.,
August 15, 2008;
14(16):
5209 - 5219.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-Y. Wu, S.-G. Wu, C.-H. Yang, C.-H. Gow, Y.-L. Chang, C.-J. Yu, J.-Y. Shih, and P.-C. Yang
Lung Cancer with Epidermal Growth Factor Receptor Exon 20 Mutations Is Associated with Poor Gefitinib Treatment Response
Clin. Cancer Res.,
August 1, 2008;
14(15):
4877 - 4882.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. R. Hirsch, R. S. Herbst, C. Olsen, K. Chansky, J. Crowley, K. Kelly, W. A. Franklin, P. A. Bunn Jr, M. Varella-Garcia, and D. R. Gandara
Increased EGFR Gene Copy Number Detected by Fluorescent In Situ Hybridization Predicts Outcome in Non-Small-Cell Lung Cancer Patients Treated With Cetuximab and Chemotherapy
J. Clin. Oncol.,
July 10, 2008;
26(20):
3351 - 3357.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Felip, F. Rojo, M. Reck, A. Heller, B. Klughammer, G. Sala, S. Cedres, S. Peralta, H. Maacke, D. Foernzler, et al.
A Phase II Pharmacodynamic Study of Erlotinib in Patients with Advanced Non-Small Cell Lung Cancer Previously Treated with Platinum-Based Chemotherapy
Clin. Cancer Res.,
June 15, 2008;
14(12):
3867 - 3874.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C.-H. Yang, C.-J. Yu, J.-Y. Shih, Y.-C. Chang, F.-C. Hu, M.-C. Tsai, K.-Y. Chen, Z.-Z. Lin, C.-J. Huang, C.-T. Shun, et al.
Specific EGFR Mutations Predict Treatment Outcome of Stage IIIB/IV Patients With Chemotherapy-Naive Non-Small-Cell Lung Cancer Receiving First-Line Gefitinib Monotherapy
J. Clin. Oncol.,
June 1, 2008;
26(16):
2745 - 2753.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. L. Keedy, C. L. Arteaga, and D. H. Johnson
Does Gefitinib Shorten Lung Cancer Survival? Chaos Redux
J. Clin. Oncol.,
May 20, 2008;
26(15):
2428 - 2430.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. V. Sequist, R. G. Martins, D. Spigel, S. M. Grunberg, A. Spira, P. A. Janne, V. A. Joshi, D. McCollum, T. L. Evans, A. Muzikansky, et al.
First-Line Gefitinib in Patients With Advanced Non-Small-Cell Lung Cancer Harboring Somatic EGFR Mutations
J. Clin. Oncol.,
May 20, 2008;
26(15):
2442 - 2449.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Liby, C. C. Black, D. B. Royce, C. R. Williams, R. Risingsong, M. M. Yore, X. Liu, T. Honda, G. W. Gribble, W. W. Lamph, et al.
The rexinoid LG100268 and the synthetic triterpenoid CDDO-methyl amide are more potent than erlotinib for prevention of mouse lung carcinogenesis
Mol. Cancer Ther.,
May 1, 2008;
7(5):
1251 - 1257.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Baselga and N. Rosen
Determinants of RASistance to Anti-Epidermal Growth Factor Receptor Agents
J. Clin. Oncol.,
April 1, 2008;
26(10):
1582 - 1584.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Giovannetti, C. Lemos, C. Tekle, K. Smid, S. Nannizzi, J. A. Rodriguez, S. Ricciardi, R. Danesi, G. Giaccone, and G. J. Peters
Molecular Mechanisms Underlying the Synergistic Interaction of Erlotinib, an Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitor, with the Multitargeted Antifolate Pemetrexed in Non-Small-Cell Lung Cancer Cells
Mol. Pharmacol.,
April 1, 2008;
73(4):
1290 - 1300.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. A. Miller, G. J. Riely, M. F. Zakowski, A. R. Li, J. D. Patel, R. T. Heelan, M. G. Kris, A. B. Sandler, D. P. Carbone, A. Tsao, et al.
Molecular Characteristics of Bronchioloalveolar Carcinoma and Adenocarcinoma, Bronchioloalveolar Carcinoma Subtype, Predict Response to Erlotinib
J. Clin. Oncol.,
March 20, 2008;
26(9):
1472 - 1478.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Peipp, T. Schneider-Merck, M. Dechant, T. Beyer, J. J. Lammerts van Bueren, W. K. Bleeker, P. W. H. I. Parren, J. G. J. van de Winkel, and T. Valerius
Tumor Cell Killing Mechanisms of Epidermal Growth Factor Receptor (EGFR) Antibodies Are Not Affected by Lung Cancer-Associated EGFR Kinase Mutations
J. Immunol.,
March 15, 2008;
180(6):
4338 - 4345.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Ciardiello and G. Tortora
EGFR Antagonists in Cancer Treatment
N. Engl. J. Med.,
March 13, 2008;
358(11):
1160 - 1174.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. A. Eberhard, G. Giaccone, and B. E. Johnson
Biomarkers of Response to Epidermal Growth Factor Receptor Inhibitors in Non-Small-Cell Lung Cancer Working Group: Standardization for Use in the Clinical Trial Setting
J. Clin. Oncol.,
February 20, 2008;
26(6):
983 - 994.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. A. Butts, D. Bodkin, E. L. Middleman, C. W. Englund, D. Ellison, Y. Alam, H. Kreisman, P. Graze, J. Maher, H. J. Ross, et al.
Randomized Phase II Study of Gemcitabine Plus Cisplatin or Carboplatin, With or Without Cetuximab, As First-Line Therapy for Patients With Advanced or Metastatic Non-Small-Cell Lung Cancer
J. Clin. Oncol.,
December 20, 2007;
25(36):
5777 - 5784.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Hohla, A. V. Schally, C. A. Kanashiro, S. Buchholz, B. Baker, C. Kannadka, A. Moder, E. Aigner, C. Datz, and G. Halmos
Growth inhibition of non-small-cell lung carcinoma by BN/GRP antagonist is linked with suppression of K-Ras, COX-2, and pAkt
PNAS,
November 20, 2007;
104(47):
18671 - 18676.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. J. Chen and C. S. Nirodi
The Epidermal Growth Factor Receptor: A Role in Repair of Radiation-Induced DNA Damage
Clin. Cancer Res.,
November 15, 2007;
13(22):
6555 - 6560.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Loprevite, M. Tiseo, M. Chiaramondia, M. Capelletti, C. Bozzetti, B. Bortesi, N. Naldi, R. Nizzoli, P. Dadati, A. Kunkl, et al.
Buccal Mucosa Cells as In vivo Model to Evaluate Gefitinib Activity in Patients with Advanced Non Small Cell Lung Cancer
Clin. Cancer Res.,
November 1, 2007;
13(21):
6518 - 6526.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. H. Kulke, L. S. Blaszkowsky, D. P. Ryan, J. W. Clark, J. A. Meyerhardt, A. X. Zhu, P. C. Enzinger, E. L. Kwak, A. Muzikansky, C. Lawrence, et al.
Capecitabine Plus Erlotinib in Gemcitabine-Refractory Advanced Pancreatic Cancer
J. Clin. Oncol.,
October 20, 2007;
25(30):
4787 - 4792.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. S. Herbst, V. J. O'Neill, L. Fehrenbacher, C. P. Belani, P. D. Bonomi, L. Hart, O. Melnyk, D. Ramies, M. Lin, and A. Sandler
Phase II Study of Efficacy and Safety of Bevacizumab in Combination With Chemotherapy or Erlotinib Compared With Chemotherapy Alone for Treatment of Recurrent or Refractory Non Small-Cell Lung Cancer
J. Clin. Oncol.,
October 20, 2007;
25(30):
4743 - 4750.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. S. Herbst, A. M. Davies, R. B. Natale, T. P. Dang, J. H. Schiller, L. L. Garland, V. A. Miller, D. Mendelson, A. D. Van den Abbeele, Y. Melenevsky, et al.
Efficacy and Safety of Single-Agent Pertuzumab, a Human Epidermal Receptor Dimerization Inhibitor, in Patients with Non Small Cell Lung Cancer
Clin. Cancer Res.,
October 15, 2007;
13(20):
6175 - 6181.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Amicarelli, E. Shehi, G. M. Makrigiorgos, and D. Adlerstein
FLAG assay as a novel method for real-time signal generation during PCR: application to detection and genotyping of KRAS codon 12 mutations
Nucleic Acids Res.,
October 11, 2007;
(2007)
gkm809v1.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. D. Bonomi, L. Buckingham, and J. Coon
Selecting Patients for Treatment with Epidermal Growth Factor Tyrosine Kinase Inhibitors
Clin. Cancer Res.,
August 1, 2007;
13(15):
4606s - 4612s.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. V. Karamouzis, J. R. Grandis, and A. Argiris
Therapies Directed Against Epidermal Growth Factor Receptor in Aerodigestive Carcinomas
JAMA,
July 4, 2007;
298(1):
70 - 82.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. E. Finberg, L. V. Sequist, V. A. Joshi, A. Muzikansky, J. M. Miller, M. Han, J. Beheshti, L. R. Chirieac, E. J. Mark, and A. J. Iafrate
Mucinous Differentiation Correlates with Absence of EGFR Mutation and Presence of KRAS Mutation in Lung Adenocarcinomas with Bronchioloalveolar Features
J. Mol. Diagn.,
July 1, 2007;
9(3):
320 - 326.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. C. Cho, C.-K. Im, M.-S. Park, S. K. Kim, J. Chang, J. P. Park, H. J. Choi, Y. J. Kim, S.-J. Shin, J. H. Sohn, et al.
Phase II Study of Erlotinib in Advanced Non-Small-Cell Lung Cancer After Failure of Gefitinib
J. Clin. Oncol.,
June 20, 2007;
25(18):
2528 - 2533.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. K. Das, B. P. Chen, M. D. Story, M. Sato, J. D. Minna, D. J. Chen, and C. S. Nirodi
Somatic Mutations in the Tyrosine Kinase Domain of Epidermal Growth Factor Receptor (EGFR) Abrogate EGFR-Mediated Radioprotection in Non-Small Cell Lung Carcinoma
Cancer Res.,
June 1, 2007;
67(11):
5267 - 5274.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Li, Y.-H. Ling, I. D. Goldman, and R. Perez-Soler
Schedule-Dependent Cytotoxic Synergism of Pemetrexed and Erlotinib in Human Non-Small Cell Lung Cancer Cells
Clin. Cancer Res.,
June 1, 2007;
13(11):
3413 - 3422.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Zundelevich, G. Elad-Sfadia, R. Haklai, and Y. Kloog
Suppression of lung cancer tumor growth in a nude mouse model by the Ras inhibitor salirasib (farnesylthiosalicylic acid)
Mol. Cancer Ther.,
June 1, 2007;
6(6):
1765 - 1773.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Massarelli, M. Varella-Garcia, X. Tang, A. C. Xavier, N. C. Ozburn, D. D. Liu, B. N. Bekele, R. S. Herbst, and I. I. Wistuba
KRAS Mutation Is an Important Predictor of Resistance to Therapy with Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors in Non-Small-Cell Lung Cancer
Clin. Cancer Res.,
May 15, 2007;
13(10):
2890 - 2896.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Dubey and C. A. Powell
Update in Lung Cancer 2006
Am. J. Respir. Crit. Care Med.,
May 1, 2007;
175(9):
868 - 874.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Hirsch, M Varella-Garcia, F Cappuzzo, J McCoy, L Bemis, A. Xavier, R Dziadziuszko, P Gumerlock, K Chansky, H West, et al.
Combination of EGFR gene copy number and protein expression predicts outcome for advanced non-small-cell lung cancer patients treated with gefitinib
Ann. Onc.,
April 1, 2007;
18(4):
752 - 760.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Benvenuti, A. Sartore-Bianchi, F. Di Nicolantonio, C. Zanon, M. Moroni, S. Veronese, S. Siena, and A. Bardelli
Oncogenic Activation of the RAS/RAF Signaling Pathway Impairs the Response of Metastatic Colorectal Cancers to Anti-Epidermal Growth Factor Receptor Antibody Therapies
Cancer Res.,
March 15, 2007;
67(6):
2643 - 2648.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. M. Jackman, B. Y. Yeap, N. I. Lindeman, P. Fidias, M. S. Rabin, J. Temel, A. T. Skarin, M. Meyerson, A. J. Holmes, A. M. Borras, et al.
Phase II Clinical Trial of Chemotherapy-Naive Patients >= 70 Years of Age Treated With Erlotinib for Advanced Non-Small-Cell Lung Cancer
J. Clin. Oncol.,
March 1, 2007;
25(7):
760 - 766.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R Dziadziuszko, B Holm, B. Skov, K Osterlind, M. Sellers, W. Franklin, P. Bunn Jr, M Varella-Garcia, and F. Hirsch
Epidermal growth factor receptor gene copy number and protein level are not associated with outcome of non-small-cell lung cancer patients treated with chemotherapy
Ann. Onc.,
March 1, 2007;
18(3):
447 - 452.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Zhang and A. Chang
Somatic mutations of the epidermal growth factor receptor and non-small-cell lung cancer
J. Med. Genet.,
March 1, 2007;
44(3):
166 - 172.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. V. Sequist, D. W. Bell, T. J. Lynch, and D. A. Haber
Molecular Predictors of Response to Epidermal Growth Factor Receptor Antagonists in Non-Small-Cell Lung Cancer
J. Clin. Oncol.,
February 10, 2007;
25(5):
587 - 595.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. V. Karamouzis, P. A. Konstantinopoulos, and A. G. Papavassiliou
The Activator Protein-1 Transcription Factor in Respiratory Epithelium Carcinogenesis
Mol. Cancer Res.,
February 1, 2007;
5(2):
109 - 120.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Buck, A. Eyzaguirre, S. Barr, S. Thompson, R. Sennello, D. Young, K. K. Iwata, N. W. Gibson, P. Cagnoni, and J. D. Haley
Loss of homotypic cell adhesion by epithelial-mesenchymal transition or mutation limits sensitivity to epidermal growth factor receptor inhibition
Mol. Cancer Ther.,
February 1, 2007;
6(2):
532 - 541.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Toschi and F. Cappuzzo
Understanding the New Genetics of Responsiveness to Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors
Oncologist,
February 1, 2007;
12(2):
211 - 220.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. B. Solit and N. Rosen
Targeting HER2 in Prostate Cancer: Where to Next?
J. Clin. Oncol.,
January 20, 2007;
25(3):
241 - 243.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N van Zandwijk, A Mathy, L Boerrigter, H Ruijter, I Tielen, D de Jong, P Baas, S Burgers, and P Nederlof
EGFR and KRAS mutations as criteria for treatment with tyrosine kinase inhibitors: retro- and prospective observations in non-small-cell lung cancer
Ann. Onc.,
January 1, 2007;
18(1):
99 - 103.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. M. Chin, D. Anuar, R. Soo, M. Salto-Tellez, W. Q. Li, B. Ahmad, S. C. Lee, B. C. Goh, K. Kawakami, A. Segal, et al.
Detection of Epidermal Growth Factor Receptor Variations by Partially Denaturing HPLC
Clin. Chem.,
January 1, 2007;
53(1):
62 - 70.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. V. Sequist, V. A. Joshi, P. A. Janne, A. Muzikansky, P. Fidias, M. Meyerson, D. A. Haber, R. Kucherlapati, B. E. Johnson, and T. J. Lynch
Response to treatment and survival of patients with non-small cell lung cancer undergoing somatic EGFR mutation testing.
Oncologist,
January 1, 2007;
12(1):
90 - 98.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. J. Riely, K. A. Politi, V. A. Miller, and W. Pao
Update on Epidermal Growth Factor Receptor Mutations in Non-Small Cell Lung Cancer
Clin. Cancer Res.,
December 15, 2006;
12(24):
7232 - 7241.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Kobayashi, T. Shimamura, S. Monti, U. Steidl, C. J. Hetherington, A. M. Lowell, T. Golub, M. Meyerson, D. G. Tenen, G. I. Shapiro, et al.
Transcriptional Profiling Identifies Cyclin D1 as a Critical Downstream Effector of Mutant Epidermal Growth Factor Receptor Signaling
Cancer Res.,
December 1, 2006;
66(23):
11389 - 11398.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P Ceppi, M Volante, S Novello, I Rapa, K. Danenberg, P. Danenberg, A Cambieri, G Selvaggi, S Saviozzi, R Calogero, et al.
ERCC1 and RRM1 gene expressions but not EGFR are predictive of shorter survival in advanced non-small-cell lung cancer treated with cisplatin and gemcitabine
Ann. Onc.,
December 1, 2006;
17(12):
1818 - 1825.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Giaccone, M. Gallegos Ruiz, T. Le Chevalier, N. Thatcher, E. Smit, J. A. Rodriguez, P. Janne, D. Oulid-Aissa, and J.-C. Soria
Erlotinib for Frontline Treatment of Advanced Non-Small Cell Lung Cancer: a Phase II Study.
Clin. Cancer Res.,
October 15, 2006;
12(20):
6049 - 6055.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. K. Das, M. Sato, M. D. Story, M. Peyton, R. Graves, S. Redpath, L. Girard, A. F. Gazdar, J. W. Shay, J. D. Minna, et al.
Non-Small Cell Lung Cancers with Kinase Domain Mutations in the Epidermal Growth Factor Receptor Are Sensitive to Ionizing Radiation
Cancer Res.,
October 1, 2006;
66(19):
9601 - 9608.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. M. Linden, K. A. Krohn, R. B. Livingston, and D. A. Mankoff
Monitoring targeted therapy: is fluorodeoxylucose uptake a marker of early response?
Clin. Cancer Res.,
October 1, 2006;
12(19):
5608 - 5610.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Amicarelli, D. Adlerstein, E. Shehi, F. Wang, and G. M. Makrigiorgos
Genotype-Specific Signal Generation Based on Digestion of 3-Way DNA Junctions: Application to KRAS Variation Detection
Clin. Chem.,
October 1, 2006;
52(10):
1855 - 1863.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. D. Carey, A. J. Garton, M. S. Romero, J. Kahler, S. Thomson, S. Ross, F. Park, J. D. Haley, N. Gibson, and M. X. Sliwkowski
Kinetic Analysis of Epidermal Growth Factor Receptor Somatic Mutant Proteins Shows Increased Sensitivity to the Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitor, Erlotinib
Cancer Res.,
August 15, 2006;
66(16):
8163 - 8171.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|