Advertisement
Journal of Clinical Oncology  
Search for:
Limit by:
  Browse by Subject or Issue
Home Search or Browse JCO My JCO Subscriptions Customer Service Site Map

Journal of Clinical Oncology, Vol 26, No 18 (June 20), 2008: pp. 2952-2958
© 2008 American Society of Clinical Oncology.
DOI: 10.1200/JCO.2007.13.5806

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a colleague
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Save to my personal folders
Right arrow Download to citation manager
Right arrowRights & Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Walsh, C. S.
Right arrow Articles by Karlan, B. Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Walsh, C. S.
Right arrow Articles by Karlan, B. Y.
Right arrowPubmed/NCBI databases
Medline Plus Health Information
*Ovarian Cancer
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

ERCC5 Is a Novel Biomarker of Ovarian Cancer Prognosis

Christine S. Walsh, Seishi Ogawa, Hisae Karahashi, Daniel R. Scoles, James C. Pavelka, Hang Tran, Carl W. Miller, Norihiko Kawamata, Charles Ginther, Judy Dering, Masashi Sanada, Yasuhito Nannya, Dennis J. Slamon, H. Phillip Koeffler, Beth Y. Karlan

From the Department of Obstetrics and Gynecology, Division of Gynecologic Oncology, and Department of Medicine, Division of Hematologic Oncology, Cedars-Sinai Women's Cancer Research Institute at the Samuel Oschin Comprehensive Cancer Institute, David Geffen School of Medicine at University of California at Los Angeles, Los Angeles, CA; and Department of Hematology/Oncology, Graduate School of Medicine, University of Tokyo, Hongo, Tokyo, Japan

Corresponding author: Christine Walsh, MD, MS, Cedars-Sinai Medical Center, 8700 Beverly Blvd, Suite 160W, Los Angeles, CA 90048; e-mail: walshc{at}cshs.org


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 AUTHORS' DISCLOSURES OF...
 AUTHOR CONTRIBUTIONS
 Appendix
 REFERENCES
 
Purpose To identify a biomarker of ovarian cancer response to chemotherapy.

Patients and Methods Study participants had epithelial ovarian cancer treated with surgery followed by platinum-based chemotherapy. DNA and RNA were isolated from frozen tumors and normal DNA was isolated from matched peripheral blood. A whole-genome loss of heterozygosity (LOH) analysis was performed using a high-density oligonucleotide array. Candidate genomic areas that predicted enhanced response to chemotherapy were identified with Cox proportional hazards methods. Gene expression analyses were performed through microarray experiments. Candidate genes were tested for independent effects on survival using Cox proportional hazards models, Kaplan-Meier survival curves, and the log-rank test.

Results Using a whole-genome approach to study the molecular determinants of ovarian cancer response to platinum-based chemotherapy, we identified LOH of a 13q region to predict prolonged progression-free survival (PFS; hazard ratio, 0.23; P = .006). ERCC5 was identified as a candidate gene in this region because of its known function in the nucleotide excision repair pathway, the unique DNA repair pathway that removes platinum-DNA adducts. We found LOH of the ERCC5 gene locus and downregulation of ERCC5 gene expression to predict prolonged PFS. Integration of genomic and gene expression data shows a correlation between 13q LOH and ERCC5 gene downregulation.

Conclusion ERCC5 is a novel biomarker of ovarian cancer prognosis and a potential therapeutic target of ovarian cancer response to platinum chemotherapy.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 AUTHORS' DISCLOSURES OF...
 AUTHOR CONTRIBUTIONS
 Appendix
 REFERENCES
 
Epithelial ovarian cancer is one of the most platinum-sensitive solid malignancies, with 70% of patients achieving a complete clinical remission after front-line therapy with a platinum-based chemotherapeutic regimen.1 However, despite this initial success, approximately 50% of patients will develop recurrent disease within 3 years of diagnosis.2 Paradoxically, although most patients initially respond to platinum chemotherapy, the majority eventually die from chemotherapy-resistant disease.3,4 The identification of molecular agents that effectively target the mechanisms of chemotherapy resistance could represent a significant advancement in our ability to treat these often fatal malignancies.5

In this study, we approached the question of response to platinum chemotherapy through an analysis of the genetic changes occurring in ovarian cancer. All patients in the analysis underwent standard surgical cytoreduction followed by an adjuvant platinum-based regimen, allowing us to probe for potential genetic markers of platinum-sensitivity. Using a whole-genome approach, we found loss of heterozygosity (LOH) at a 13q region to strongly predict prolonged progression-free survival (PFS). Within this region, we identified the ERCC5 gene, which encodes the XPG protein. XPG is a key member of nucleotide excision repair (NER) pathway, the DNA repair mechanism responsible for removing bulky DNA adducts. We hypothesized that a loss of XPG function would be correlated with diminished ability to repair platinum-induced DNA damage, enhanced platinum-sensitivity, and prolonged PFS. We found associations between LOH of 13q, which is the ERCC5 gene locus, and prolonged PFS, ERCC5 downregulation and prolonged PFS, as well as a correlation between LOH of 13q and ERCC5 gene downregulation.

Our findings lend support to prior work that has suggested the importance of the NER pathway in response to platinum-based chemotherapy and suggests ERCC5 (XPG) as a novel candidate biomarker of ovarian cancer response to platinum chemotherapy. Further work on this pathway may validate XPG as a diagnostic marker and/or lead to the development of a therapeutic agent that specifically targets XPG activity for the sensitization of platinum-resistant malignancies.


    PATIENTS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 AUTHORS' DISCLOSURES OF...
 AUTHOR CONTRIBUTIONS
 Appendix
 REFERENCES
 
Patient Samples
All patient samples were collected at Cedars-Sinai Medical Center using protocols approved by the Cedars-Sinai institutional review board. After patients provided informed consent, fresh tumor tissue was snap-frozen in liquid nitrogen and stored in a –80°C freezer. Study participants were treated with surgical cytoreduction followed by platinum-based chemotherapy regimen and had corresponding clinical and follow-up information.

DNA was isolated from frozen tumor samples using the Qiagen DNeasy Tissue Protocol (QIAGEN, Valencia, CA). RNA was isolated from frozen tumor samples using the RNeasy kit (QIAGEN). Genomic DNA was isolated from matched peripheral-blood samples using a standard phenol chloroform extraction method. DNA and RNA quantities were measured with the Nanodrop spectrophotometer (Thermo Scientific, Wilmington, DE). RNA quality was determined through separation by capillary electrophoresis on the Agilent 2000 Bioanalyzer (Agilent Technologies, Foster City, CA). Microarray analysis was performed with high-quality RNA, defined as an RNA integrity number greater than 8.

DNA Genomic Analysis Using GeneChip Mapping 50K High-Density Oligonucleotide Array
Array experiments were performed using standard Affymetrix protocols (Affymetrix, Santa Clara, CA). For each sample, 250 ng of total genomic DNA was digested with XbaI restriction enzyme and ligated to common adaptors, which allowed for polymerase chain reaction (PCR) amplification of the entire genome using a single pair of primers. PCR products were digested, labeled, and hybridized to the 50K Xba high-density oligonucleotide microarray, which contains a marker distance of approximately 50 kb between single-nucleotide polymorphisms.

GeneChip Data Analysis
Genotype calls were processed using the Copy Number Analyzer for GeneChip software program (CNAG; University of Tokyo, Tokyo, Japan; http://www.genome.umin.ac.jp).6 Matched peripheral-blood DNA was used as the reference for each tumor DNA sample. Each genomic region was classified as normal, amplified, deleted, or as a region of copy-neutral LOH (also known as uniparental disomy). Summary graphs were generated with STATA v8 (STATA Corp, College Station, TX) to graphically display the range and locations of each genetic abnormality.

A discrete variable was created for each genomic block affected by LOH in at least 20% of cases. In all, 106 LOH variables were defined across the tumor genome and each was tested as a predictor affecting PFS. Cox proportional hazards methods were used to determine hazard ratios (HR) for each variable. Associations were reported if the two-sided P values were less than .05. Multivariate Cox models were generated to control for the effects of confounding factors. As this was an exploratory analysis, corrections were not made for multiple testing.

Identification of Candidate Genes
Genomic LOH regions were found to predict prolonged PFS. These regions were hypothesized to harbor important tumor suppressor genes that mediate response to platinum-based chemotherapy. Candidate genes were identified through a direct link from the CNAG chromosome viewer to the University of California at Santa Cruz Genome Browser Build 17 (hg17) Human May 2004 assembly, based on the National Center for Biotechnology Information Build 35 (University of California at Santa Cruz, Santa Cruz, CA; http://genome.ucsc.edu/index.html). Predicted and reference sequence genes were investigated to narrow the candidate gene list.

LOH Analysis at Candidate Gene Locus
ERCC5, a DNA repair gene from the NER pathway, was identified as a biologically plausible modulator of ovarian cancer response to platinum-based chemotherapy. The LOH status at the ERCC5 gene locus was evaluated in 44 clinical ovarian cancer samples to determine its specific effect on ovarian cancer prognosis. All were papillary serous histology, stages IIC to IV; 10 were common to the GeneChip data set. For each sample, a dinucleotide repeat polymorphism located within an intron of the ERCC5 gene was amplified in tumor and matched normal DNA. Previously published primer sequences7 were lengthened to enhance the specificity of the reaction (Forward-Fam labeled 5'GCA ATG ACT CGG TAT TGG CTA AT 3'; Reverse 5' GAT GCT AAC AAG TGG GTG GAA T 3'). PCR was performed with 15-µL reactions containing 20 ng of genomic DNA, 20 pmole of each primer, 0.75 µL of AmpliTaq DNA polymerase (Applied Biosystems, Foster City, CA), and 2x dNTP (Epicenter, Madison, WI) on a GeneAmp PCR System 9700 (Applied Biosystems). PCR products were verified on 2% agarose gel and run in the University of California at Los Angeles genotyping core facility. LOH was determined in samples with a homozygous genotype in tumor DNA and a heterozygous genotype in the matched normal DNA.

Gene Expression Analysis
The significance of expression of ERCC5 and other ERCC gene expression were tested using high-quality RNA extracted from 90 ovarian cancer samples. Microarray analysis was performed on the Agilent Human 1A V2 chip. Samples were labeled using the Agilent Low RNA Input Fluorescent Linear Amplification Kit. Each individual sample was labeled with cyanine-5 and characterized by comparison to a mixed reference pool labeled with cyanine-3. The mixed reference pool consisted of equal amounts of cRNA from 106 clinical samples from the tumor bank, ranging from benign to malignant, and chosen to be representative of the range of histologic pathologies occurring in the female reproductive tract. An Agilent Scanner and the Agilent Feature Extraction software version 7.5 were used to read the microarray slides and calculate gene expression values. Gene expression values of the candidate genes (ERCC1-ERCC6, ERCC8) were exported to STATA and linked to clinical data. The threshold for downregulation was defined as log(ratio) less than 0 with a P value of less than .05. The P values were determined according to the Agilent error model with the feature-extracted data imported into Resolver. Cox proportional hazards models, Kaplan-Meier survival curves, and the log-rank test were used to determine the effects of ERCC gene expression on PFS.

Quantitative PCR Validation of Gene Expression
Microarray gene expression data were validated by quantitative real-time PCR performed using the SYBR Green method (Invitrogen, Carsbad, CA) with standard curves on iCycler (Bio-Rad, Hercules, CA). RNA was converted to cDNA using the QuaniTect Reverse Transcription kit (QIAGEN). PCR reactions were performed in 96-well plates with 12.5 µL 0f SYBR Green, 0.5 µL of primer, and cDNA in a total reaction volume of 25 µL. ERCC5 was amplified with the following primers: Forward CAGACACAGCTCCGAATTGA; Reverse TTCTGGGTTTTTCGTTTTGC. Expression of ERCC5 was normalized by 18srRNA subunit expression with the following primers: Forward CGCCGTGCCTACCATGGTGAC; Reverse CTTGGATGTGGTAGCCGTTTCTCA.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 AUTHORS' DISCLOSURES OF...
 AUTHOR CONTRIBUTIONS
 Appendix
 REFERENCES
 
Study Overview and Patient Characteristics
A whole-genome analysis of the genetic changes occurring in the DNA of 20 tumors was performed to identify candidate regions that predicted improved response to treatment. Effect of LOH at the candidate gene locus was analyzed in 52 total samples. Association of RNA expression levels with prognosis was tested in 90 tumors. Patient characteristics among the three data sets are listed in Table 1. All patients were treated with initial cytoreductive surgery followed by adjuvant chemotherapy with a platinum-containing regimen. PFS was defined as the time from date of primary cytoreductive surgery to the date of first clinical evidence of recurrence. Overall survival was defined as the time from date of primary cytoreductive surgery to the date of death or censored at the date of last follow-up.


View this table:
[in this window]
[in a new window]

 
Table 1. Patient Characteristics at Diagnosis

 
Characterization of Genomic Abnormalities in Ovarian Cancer DNA
Appendix Figure A1A (online only) is a representative example of how the visual output from the CNAG software program was converted into a color-coded graphical representation of genetic changes (amplification, deletion, or uniparental disomy). This method allowed us to summarize the genetic heterogeneity and complexity occurring over the 20 ovarian cancer samples (Appendix Fig A1B).

A similar summary graph demonstrates the frequency of LOH in the ovarian tumor genomes (Appendix Fig A1C). The LOH data were further summarized in a frequency plot demonstrating the proportion of cases affected by LOH at each genomic locus (Appendix Fig A1D).

Predictors of Prolonged PFS
LOH blocks on chromosomes 2, 5, 13, and 22 were found to predict prolonged PFS (point estimates for HRs ranging from 0.23 to 0.36; Table 2), suggesting a survival benefit owing to loss of function of genes in the regions. Adjusted HRs were calculated for each LOH block to account for the potential confounding effects of various clinical variables. LOH of the 13q (54 to 102 MB) block was found to retain a highly significant independent association with prolonged PFS after adjustment for various confounders (Table 2).


View this table:
[in this window]
[in a new window]

 
Table 2. Genomic LOH Loci Correlating With Significantly Improved PFS

 
A Candidate Gene That May Predict Response to Platinum Chemotherapy
The 48-MB region on 13q (54 to 102 MB) contains 73 genes (Appendix Table A1, online only), including ERCC5. We felt this gene deserved further study given its role in the NER pathway, the unique DNA repair pathway that allows cells to remove platinum adducts from DNA. We hypothesized that LOH of this 13q region leads to downregulation of ERCC5 levels, a diminished capacity of tumor cells to recover from platinum-based chemotherapy (enhanced chemotherapy sensitivity), and prolonged PFS.

Effect of LOH of ERCC Gene Locus on Survival
The LOH status of the ERCC5 gene locus was determined through genotyping of a dinucleotide repeat polymorphism (DRP) in 44 samples. Fourteen genotypes (32%) were noninformative because of a homozygous genotype in both normal and tumor DNA. Genotype data were available from 20 samples by GeneChip analysis. Ten samples were genotyped by both methods, resulting in 54 total samples genotyped. Among the 10 overlapping samples, six genotypes were correlated, two were noninformative on DRP analysis, and two were contradictory on the basis of the finding of LOH on GeneChip but no LOH on DRP analysis. In the four noncorrelating samples, LOH status was analyzed based on GeneChip data as a result of the self-validating nature of the genotyping of multiple single-nucleotide polymorphisms with the whole-genome approach.

Among the 54 samples genotyped, 29 (54%) had no LOH, 13 (24%) had LOH, and 12 (22%) were noninformative. LOH at the ERCC5 locus (13 of 42) demonstrated a trend toward improved PFS (Fig 1A). A subset analysis limited to the stage IIC to IIIC papillary serous tumors (nine of 29) demonstrated a significant improvement in PFS (Fig 1B).


Figure 1
View larger version (17K):
[in this window]
[in a new window]
[PowerPoint Slide for Teaching]
 
Fig 1. Survival differences based on ERCC5 loss of heterozygosity (LOH) and gene expression. (A) Trend toward improved progression-free survival (PFS) among patients with LOH of ERCC5 gene locus (P = .1) and (B) improved PFS in the subset of patients with stage IIC to IIIC disease (P = .01). (C) Improved PFS (P = .004) and (D) overall survival (P = .08) among patients with downregulation of ERCC5 gene expression.

 
At the time of second-look surgery, patients with LOH at the ERCC5 locus were significantly more likely to have a pathologic complete response (five of six; 83%) than those without LOH (two of eight; 25%; P = .03).

Effect of ERCC Gene Expression on Survival
Gene expression levels of the various ERCC genes (ERCC1 through ERCC6, ERCC8) were analyzed for influences on survival in a data set of 90 patients. PFS (Fig 1C) and OS (Fig 1D) were both prolonged among patients with ERCC5 downregulation in the tumors. This effect was not seen for ERCC1, ERCC2, ERCC3, ERCC4, ERCC6, or ERCC8 downregulation (Appendix Figs A2 through A7, online only). Microarray gene expression analysis was validated using quantitative real-time PCR (Fig 2).


Figure 2
View larger version (8K):
[in this window]
[in a new window]
[PowerPoint Slide for Teaching]
 
Fig 2. Quantitative polymerase chain reaction (PCR) validation of ERCC5 gene expression. Mean differential quantitative PCR gene expression between cases with high (n = 11) and low (n = 8) ERCC5 expression on microarray analysis (P = .06.).

 
Table 3 demonstrates the results from Cox proportional hazards regression models. On univariate analysis, a beneficial impact on PFS is seen with ERCC5 downregulation (HR = 0.44; P = .01), but not with downregulation of any other single ERCC gene. On multivariate analysis, ERCC5 downregulation retains an independent beneficial impact on PFS (HR = 0.49; P = .03).


View this table:
[in this window]
[in a new window]

 
Table 3. Cox Proportional Hazards Regression: Impact of Clinical and ERCC Gene Expression Data on Progression-Free Survival

 
Correlation Between ERCC5 LOH and Gene Expression Levels
Forty tumors with DNA and RNA data were analyzed for correlation between LOH of the 13q (ERCC5) locus and ERCC5 expression levels. Expression levels are lower in the group of tumors with LOH (mean fold change, –0.59; median –1.12) compared with the tumors without LOH (mean fold change, +0.84; median, +1.03; P = .08). This suggests possible biologic validity of ERCC5 as a target gene within the 13q region.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 AUTHORS' DISCLOSURES OF...
 AUTHOR CONTRIBUTIONS
 Appendix
 REFERENCES
 
Our study identifies ERCC5 as a novel candidate biomarker of ovarian cancer sensitivity to platinum chemotherapy. This conclusion is supported on several different levels. We found LOH of the 13q locus containing ERCC5 to predict prolonged PFS among platinum-treated patients with ovarian cancer. Additional genotyping also confirmed an association between LOH of the ERCC5 gene locus and improved survival. Furthermore, downregulation of ERCC5 mRNA expression levels also predicted prolonged PFS in an independent data set. Finally, the correlation between LOH of the ERCC5 genomic locus with downregulation of ERCC5 mRNA levels among the subset of tumors with integrated genomic and gene expression data suggests possible biologic plausibility of ERCC5 being a target gene in the 13q LOH region.

Further biologic plausibility is apparent when placing these findings in the context of previous knowledge and work. Defective DNA repair pathways allow tolerance to DNA damage, permitting an accelerated rate of mutagenesis and neoplastic transformation. This characteristic turns to the disadvantage of the cancer cell when DNA damaging cancer therapies are administered, leading to an enhanced response to treatment.8 We have found evidence to support the hypothesis that a downregulation of ERCC5 activity leads to enhanced platinum chemotherapy sensitivity in ovarian cancer. This is provocative when considering the function of ERCC5 in the NER pathway, the unique DNA repair pathway that repairs DNA damage caused by platinum agents.

NER recognizes and repairs bulky, helix-distorting adducts, such as those formed by cisplatin and its analogs.9,10 A complex of proteins assembles, binds bulky DNA damage, incises the oligonucleotide fragment containing the damaged base, and fills in the resulting gap.11,12 Platinum-resistant cells are able to more effectively remove cisplatin-DNA adducts through the action of a functional NER pathway and thus escape apoptosis.

ERCC5 (XPG) is a structure-specific endonuclease, which participates in two incision steps that are critical to the DNA repair process. XPG cleaves the damaged DNA 3' to the damaged site, nonenzymatically participates in the 5' incision mediated by the XPF/ERCC1 heterodimer, and stabilizes the DNA repair complex to the damaged DNA.13-16 XPG is critical to both subpathways of NER: transcription-coupled repair (TCR), which specifically targets and repairs DNA damage on the transcribed strand of actively expressed genes, and global genomic repair (GGR), which removes DNA damage from the remaining genome.17 TCR and GGR each have a unique mechanism for recognizing DNA damage, then progress along a common pathway that requires XPG.11,12

A number of studies provide evidence for the role of the NER pathway in cellular response to platinum chemotherapy, consistently demonstrating platinum-resistance with enhanced NER activity and platinum-sensitivity with diminished NER activity. Cisplatin-resistant cells have been shown to have increased levels of XPA mRNA,18 overexpression of ERCC1 or ERCC1/XPF,19 increased activity of ERCC1/XPD,20 and increased XPC and ERCC1 levels.21 Hypersensitivity of some cell lines may be related to reduced expression of XPG or XPA.9 Inhibition of ERCC1 activity with antisense oligonucleotides enhances cisplatin sensitivity in ovarian cancer cell lines.22 Cells with deficiencies in GGR-specific factors (XPC) display normal resistance to cisplatin, whereas cells with deficiencies in TCR-specific (CSA, CSB) or common pathway proteins (XPA, XPD, XPF, XPG) are markedly hypersensitive to cisplatin.23 The excellent response rates of testicular cancer to cisplatin may be due to a high rate of NER deficiencies.24

Our study adds to this body of literature, suggesting that loss of ERCC5 function occurs naturally during the carcinogenic process of a subset of ovarian cancers and consequently leads to inherent platinum chemotherapy sensitivity. This speculation is supported by the finding of LOH of regions harboring NER genes occurring at a higher frequency in ovarian cancers (62%) than in other solid tumors, such as colon or lung cancer.25 Ours is not the first study to report frequent LOH of the 13q locus in epithelial ovarian cancer.26

Our findings have important prognostic and therapeutic implications. Tumors with dysfunctional ERCC5 expression would be predicted to demonstrate sensitivity to platinum-based therapy. ERCC5 (XPG) may be an appropriate target for therapeutic inhibition in platinum-resistant ovarian cancers. XPG is a critical component of the rate-limiting damage recognition/excision step of NER27 and is expressed at lower cellular protein levels than other NER factors.28 XPG levels are correlated with cytotoxicity to cisplatin and irofulven and with cellular NER activity,28 potentially making it an attractive therapeutic target. A recent integrated analysis of array CGH and gene expression profiling data in testicular cancers also found ERCC5 to be both lost and downregulated.29 Ovarian cancer and testicular cancer share the quality of platinum chemotherapy sensitivity, and data are emerging to suggest that NER dysfunction (particularly ERCC5) may be another shared characteristic. Further work may lead to the development of a specific XPG inhibitor that can sensitize platinum-resistant tumors to the effects of platinum chemotherapy.

Platinum drugs demonstrate activity in a wide range of tumors, including ovarian, cervical, testicular, head and neck, and non–small-cell lung cancer,30 but their use is often limited by the development of resistance. A number of complex pathways are involved, including decreased drug uptake into the cell, increased drug inactivation, and increased DNA repair.31 Further insights into these mechanisms could be used to develop rational biologic therapies that target platinum resistance.32


    AUTHORS’ DISCLOSURES OF POTENTIAL CONFLICTS OF INTEREST
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 AUTHORS' DISCLOSURES OF...
 AUTHOR CONTRIBUTIONS
 Appendix
 REFERENCES
 
The author(s) indicated no potential conflicts of interest.


    AUTHOR CONTRIBUTIONS
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 AUTHORS' DISCLOSURES OF...
 AUTHOR CONTRIBUTIONS
 Appendix
 REFERENCES
 
Conception and design: Christine S. Walsh, Dennis J. Slamon, H. Phillip Koeffler, Beth Y. Karlan

Financial support: Seishi Ogawa, Dennis J. Slamon, H. Phillip Koeffler, Beth Y. Karlan

Provision of study materials or patients: Beth Y. Karlan

Collection and assembly of data: Christine S. Walsh, Hisae Karahashi, Daniel R. Scoles, James C. Pavelka, Hang Tran, Charles Ginther, Judy Dering, Masashi Sanada, Yasuhito Nannya

Data analysis and interpretation: Christine S. Walsh, Seishi Ogawa, Carl W. Miller, Norihiko Kawamata

Manuscript writing: Christine S. Walsh

Final approval of manuscript: Christine S. Walsh, Seishi Ogawa, Hisae Karahashi, Daniel R. Scoles, James C. Pavelka, Carl W. Miller, Norihiko Kawamata, Charles Ginther, Judy Dering, Masashi Sanada, Yasuhito Nannya, Dennis J. Slamon, H. Phillip Koeffler, Beth Y. Karlan


    Appendix
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 AUTHORS' DISCLOSURES OF...
 AUTHOR CONTRIBUTIONS
 Appendix
 REFERENCES
 
Go


Figure 3
View larger version (36K):
[in this window]
[in a new window]
[PowerPoint Slide for Teaching]
 
Fig A1. (A) Genomic abnormalities as demonstrated by Copy Number Analyzer for GeneChip visual output and simplified color-coded graphical representation. (B) Each case is horizontally displayed with color-coded abnormalities mapped along the genome (chromosome 1 to X along the x-axis). (C) Regions of LOH (pink). (D) Frequency plot demonstrating the proportion of cases with LOH at each genetic loci. LOH, loss of heterozygosity; Amp, amplification; UPD, uniparental disomy; Del, deletion.

 
Go


Figure 4
View larger version (18K):
[in this window]
[in a new window]
[PowerPoint Slide for Teaching]
 
Fig A2. No difference in (A) progression-free (P = .7) or (B) overall survival (P = .7) based on ERCC1 gene expression.

 
Go


Figure 5
View larger version (18K):
[in this window]
[in a new window]
[PowerPoint Slide for Teaching]
 
Fig A3. No difference in (A) progression-free survival (P = .8) or (B) overall survival (P = .8) based on ERCC2 expression.

 
Go


Figure 6
View larger version (19K):
[in this window]
[in a new window]
[PowerPoint Slide for Teaching]
 
Fig A4. No difference in (A) progression-free survival (P = .9) or (B) overall survival (P = .5) based on ERCC3 expression.

 
Go


Figure 7
View larger version (18K):
[in this window]
[in a new window]
[PowerPoint Slide for Teaching]
 
Fig A5. No difference in (A) progression-free survival (P = .3) and (B) overall survival (P = .8) based on ERCC4 expression.

 
Go


Figure 8
View larger version (18K):
[in this window]
[in a new window]
[PowerPoint Slide for Teaching]
 
Fig A6. No difference in (A) progression-free survival (P = .9) and (B) overall survival (P = .9) based on ERCC6 expression.

 
Go


Figure 9
View larger version (18K):
[in this window]
[in a new window]
[PowerPoint Slide for Teaching]
 
Fig A7. No difference in (A) progression-free survival (P = .8) or (B) overall survival (P = .5) based on ERCC8 expression.

 
Go


View this table:
[in this window]
[in a new window]

 
Table A1. Details of 73 Genes in LOH Locus 13q: 54,217,914-102,557,751

 


    ACKNOWLEDGMENTS
 
We thank Jenny Gross for administrative support in this research.


    NOTES
 
Supported by Borden Family Foundation (D.R.S., H.K.), Milken Family Foundation (C.S.W., B.Y.K.), Pacific Ovarian Cancer Foundation (Grant No. P50 CA83636; Principal Investigator, Nicole Urban; Carerr Development Grant to C.S.W.), General Clinical Research Center Grant No. M01-RR00425 (C.S.W.), Revlon/University of California at Los Angeles Women's Cancer Research Program (D.J.S.), Entertainment Industries Foundation (D.J.S.), and Grant-in-Aid for Scientific Research supported by the Japan Society for the Promotion of Science (S.O.).

Presented in part at the 11th Biennial Meeting of the International Gynecologic Cancer Society, October 14-18, 2006, Santa Monica, CA, and the 38th Annual Meeting of the Society of Gynecologic Oncologists, March 3-7, 2007, San Diego, CA.

Authors’ disclosures of potential conflicts of interest and author contributions are found at the end of this article.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 AUTHORS' DISCLOSURES OF...
 AUTHOR CONTRIBUTIONS
 Appendix
 REFERENCES
 
1. McGuire WP 3rd, Markman M: Primary ovarian cancer chemotherapy: Current standards of care. Br J Cancer 89:S3-S8, 2003 (suppl 3)

2. Högberg T, Glimelius B, Nygren P: A systematic overview of chemotherapy effects in ovarian cancer. Acta Oncol 40:340-360, 2001[Medline]

3. Piccart MJ, Lamb H, Vermorken JB: Current and future potential roles of the platinum drugs in the treatment of ovarian cancer. Ann Oncol 12:1195-1203, 2001[Abstract/Free Full Text]

4. Harries M, Kaye SB: Recent advances in the treatment of epithelial ovarian cancer. Expert Opin Investig Drugs 10:1715-1724, 2001[CrossRef][Medline]

5. Giaccone G: Clinical perspectives on platinum resistance. Drugs 59:9-17, 2000 (suppl 4)

6. Nannya Y, Sanada M, Nakazaki K, et al: A robust algorithm for copy number detection using high-density oligonucleotide single nucleotide polymorphism genotyping arrays. Cancer Res 65:6071-6079, 2005[Abstract/Free Full Text]

7. Samec S, Clarkson SG, Blaschak J, et al: Dinucleotide repeat polymorphism within ERCC5 gene. Hum Mol Genet 3:214, 1994[Free Full Text]

8. Kennedy RD, D'Andrea AD: DNA repair pathways in clinical practice: Lessons from pediatric cancer susceptibility syndromes. J Clin Oncol 24:3799-3808, 2006[Abstract/Free Full Text]

9. Kelland LR: Preclinical perspectives on platinum resistance. Drugs 59:1-8, 2000 (suppl 4)[Medline]

10. Kartalou M, Essigmann JM: Mechanisms of resistance to cisplatin. Mutat Res 478:23-43, 2001[Medline]

11. Friedberg EC: How nucleotide excision repair protects against cancer. Nat Rev Cancer 1:22-33, 2001[CrossRef][Medline]

12. Park CJ, Choi BS: The protein shuffle: Sequential interactions among components of the human nucleotide excision repair pathway. Febs J 273:1600-1608, 2006[CrossRef][Medline]

13. Dunand-Sauthier I, Hohl M, Thorel F, et al: The spacer region of XPG mediates recruitment to nucleotide excision repair complexes and determines substrate specificity. J Biol Chem 280:7030-7037, 2005[Abstract/Free Full Text]

14. O'Donovan A, Davies AA, Moggs JG, et al: XPG endonuclease makes the 3' incision in human DNA nucleotide excision repair. Nature 371:432-435, 1994[CrossRef][Medline]

15. Wakasugi M, Reardon JT, Sancar A: The non-catalytic function of XPG protein during dual incision in human nucleotide excision repair. J Biol Chem 272:16030-16034, 1997[Abstract/Free Full Text]

16. Constantinou A, Gunz D, Evans E, et al: Conserved residues of human XPG protein important for nuclease activity and function in nucleotide excision repair. J Biol Chem 274:5637-5648, 1999[Abstract/Free Full Text]

17. Hanawalt PC: Controlling the efficiency of excision repair. Mutat Res 485:3-13, 2001[Medline]

18. States JC, Reed E: Enhanced XPA mRNA levels in cisplatin-resistant human ovarian cancer are not associated with XPA mutations or gene amplification. Cancer Lett 108:233-237, 1996[CrossRef][Medline]

19. Ferry KV, Hamilton TC, Johnson SW: Increased nucleotide excision repair in cisplatin-resistant ovarian cancer cells: Role of ERCC1-XPF. Biochem Pharmacol 60:1305-1313, 2000[CrossRef][Medline]

20. Yu JJ, Bicher A, Ma YK, et al: Absence of evidence for allelic loss or allelic gain for ERCC1 or for XPD in human ovarian cancer cells and tissues. Cancer Lett 151:127-132, 2000[CrossRef][Medline]

21. Dabholkar M, Bostick-Bruton F, Weber C, et al: ERCC1 and ERCC2 expression in malignant tissues from ovarian cancer patients. J Natl Cancer Inst 84:1512-1517, 1992[Abstract/Free Full Text]

22. Selvakumaran M, Pisarcik DA, Bao R, et al: Enhanced cisplatin cytotoxicity by disturbing the nucleotide excision repair pathway in ovarian cancer cell lines. Cancer Res 63:1311-1316, 2003[Abstract/Free Full Text]

23. Furuta T, Ueda T, Aune G, et al: Transcription-coupled nucleotide excision repair as a determinant of cisplatin sensitivity of human cells. Cancer Res 62:4899-4902, 2002[Abstract/Free Full Text]

24. Köberle B, Masters JR, Hartley JA, et al: Defective repair of cisplatin-induced DNA damage caused by reduced XPA protein in testicular germ cell tumours. Curr Biol 9:273-276, 1999[CrossRef][Medline]

25. Takebayashi Y, Nakayama K, Kanzaki A, et al: Loss of heterozygosity of nucleotide excision repair factors in sporadic ovarian, colon and lung carcinomas: Implication for their roles of carcinogenesis in human solid tumors. Cancer Lett 174:115-125, 2001[CrossRef][Medline]

26. Yang-Feng TL, Li S, Han H, et al: Frequent loss of heterozygosity on chromosomes Xp and 13q in human ovarian cancer. Int J Cancer 52:575-580, 1992[Medline]

27. Shivji KK, Kenny MK, Wood RD: Proliferating cell nuclear antigen is required for DNA excision repair. Cell 69:367-374, 1992[CrossRef][Medline]

28. Koeppel F, Poindessous V, Lazar V, et al: Irofulven cytotoxicity depends on transcription-coupled nucleotide excision repair and is correlated with XPG expression in solid tumor cells. Clin Cancer Res 10:5604-5613, 2004[Abstract/Free Full Text]

29. Skotheim RI, Autio R, Lind GE, et al: Novel genomic aberrations in testicular germ cell tumors by array-CGH, and associated gene expression changes. Cell Oncol 28:315-326, 2006[Medline]

30. Wang D, Lippard SJ: Cellular processing of platinum anticancer drugs. Nat Rev Drug Discov 4:307-320, 2005[CrossRef][Medline]

31. Rabik CA, Dolan ME: Molecular mechanisms of resistance and toxicity associated with platinating agents. Cancer Treat Rev 33:9-23, 2007[CrossRef][Medline]

32. Wernyj RP, Morin PJ: Molecular mechanisms of platinum resistance: Still searching for the Achilles’ heel. Drug Resist Updat 7:227-232, 2004[CrossRef][Medline]

Submitted July 19, 2007; accepted March 4, 2008.


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Facebook Facebook   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?



This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a colleague
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Save to my personal folders
Right arrow Download to citation manager
Right arrowRights & Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Walsh, C. S.
Right arrow Articles by Karlan, B. Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Walsh, C. S.
Right arrow Articles by Karlan, B. Y.
Right arrowPubmed/NCBI databases
Medline Plus Health Information
*Ovarian Cancer
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

About
JCO
 Editorial
Roster
 Advertising
Information
 Librarians &
Institutions
 Rights &
Permissions
 PDA Services

Copyright © 2008 by the American Society of Clinical Oncology, Online ISSN: 1527-7755. Print ISSN: 0732-183X
Terms and Conditions of Use
  HighWire Press HighWire Press™ assists in the publication of JCO Online